Витамины для активного роста волос: Витамины для волос, кожи, ногтей купить по низкой цене в Москве в интернет аптеке

Содержание

ANAGAIN NU | Kraftway Clinic

Биологически активная добавка для роста волос и ногтей

Добавка с действующим составом на всех стадиях роста волос!

«Питьевой восстановитель волос» стимулирует рост волос, сокращает стадию отдыха волосяной луковицы. Содержит необходимое питание для роста волос в виде аминокислот и для ускорения синтеза – витамины и минералы. Способствует росту густых и шелковистых волос, нормализует жизненный цикл роста волос, нарушенный возрастными показателями или стрессовыми ситуациями!

Показания к применению:
 

  • Восстановление жизненного цикла  роста волос
  • Защита фолликул от окислительного стресса
  • Поддержка здоровья волос и ногтей 
  • Торможение процесса появления седых волос

РЕКОМЕНДАЦИИ ПО ПРИМЕНЕНИЮ:

Взрослым принимать в качестве добавки к
пище по одной (1) капсуле в день,
запивая водой.
СОСТАВ:

  • В 1 капсуле содержится:
  • Активные компоненты:
  • Экстракт проростков горошка
  • AnaGain™ Nu — 33.33мг
  • Кератин — 33.33мг
  • Цистеин — 80мг
  • Метионин — 33.33мг
  • Цинк — 33.33мг
  • Экстракт семян камелии (25% сапонин)
    — 8.33мг
  • Экстракт черного кунжута (70%
    сезамин) — 0.48мг
  • Экстракт чёрного перца BIOPERINE®
    (95% пиперина) — 1.67мг
  • Порошок ламинарии японской
    (кагомэ), содержащей йод, — 35мкг
  • Витамин B1 (гидрохлорид тиамина)
    1мг
  • Витамин В2 (рибофлавин) — 1.10мг
  • Витамин B6 (пиридоксина
    гидрохлорид) — 1.2мг
  • Витамин B12 (цианокобаламин) — 2.4мг
  • Пантотенат кальция — 15мг
  • Биотин — 3.33мг
  • Витамин Е — 4мг

Суточная доза: 1 капсула.

 

Основные ингредиенты:

Экстракт проростков горошка AnaGain™ Nu

швейцарское запатентованное сырьё,
выделенное из молодых проростков горошка и доказавшее свою эффективность.

Восстанавливает жизненный цикл роста волоса путем сокращения «стадии отдыха», которая
является причиной выпадения волос, а также способствует росту волос в «стадии активного
роста».

Кератин

молекула, проникающая в волосы и питающая волосяной фолликул. Кератин
наполняет структуру волос, заполняет трещины, разрушает и восстанавливает кератиновый
слой. Этот компонент хорошо удерживает влагу, поэтому он питает и тонизирует кожу.

Цистеин

24% кератина состоит из цистеина — заменимой аминокислоты, которую организм
синтезирует из метионина. Аминокислота защищает фолликулы от окислительного стресса,
насыщает волосы серой, которая в свою очередь улучшает их структуру и прочность.
Способствует формированию коллагена, от которого зависит эластичность и упругость кожи.

Метионин

влияет на объем стержня волоса (т.е. на его толщину), питает и предотвращает

ломкость и выпадение волос. Аминокислота является источником серы, которая необходима
для синтеза цистеина.

Цинк (цинк глюконат)

влияет на усвоение белков, нормализует выработку кожного сала и
принимает участие в формировании волосяной структуры. Цинк входит в состав ферментов,обеспечивающих обменные процессы и правильную работу внутренних органов, принимает
участие в синтезе половых гормонов, влияющих на густоту волосяного покрова, способствует
быстрому заживлению кожных повреждений.

Экстракт семян камелии

более 25% компонента красоты, камелиевого сапонина, обладает
высоким тепловым эффектом , он запатентован как средство для восстановления волос.

Экстракт черного кунжута

вместе с  питанием кожи головы и стимулированием роста волос
чёрные кунжутные семечки, содержащие 70% сезамина, повышают активность меланоцита для
производства меланина – пигмента, отвечающего за цвет волос и кожи, тем самым замедляют

процесс появления седых волос.

BIOPERINE®

природный биоэнхансер из чёрного перца, содержащий 95% пиперина и
повышающий биодоступность витаминов.

Порошок ламинарии японской (кагомэ)

ламинария, содержащая йод, нормализует
выработку гормонов щитовидной железы. Йод — один из ключевых элементов для
поддержания прочности и усиления роста волос.

Витамин B1

(гидрохлорид тиамина) — выполняет функцию регуляции обменных процессов,
обеспечивает волосяные фолликулы необходимой энергией.

Витамин В2

(рибофлавин) — поставляет кислород клеткам кожи головы, поэтому питательные
вещества лучше проникают к корням волос. Отлично улучшает кровообращение, регулирует
обменные процессы в организме, что позволяет волосам полноценно получать белки, жиры и
углеводы.

Витамин B6 

(пиридоксина гидрохлорид)

предотвращает появление зуда и сухости головы — одной из причин появления перхоти.

Витамин B12 (цианокобаламин)

ускоряет рост волос, укрепляет корни благодаря участию в
синтезе кровяных клеток. Повышает качество крови, способствует хорошему питанию корней.
Увеличивает густоту волос за счет пробуждения спящих луковиц.

Пантотенат кальция

оказывает метаболическое действие,ускоряет процессы
регенерации,участвует в жировом,углеводном обмене,применяется для восстановления волос.

Биотин 

недостаток биотина напрямую связан с выпадением волос. Биотин провоцирует
создание эритроцитов, переносящих кислород и питательные вещества к коже головы и
волосяным фолликулам.

Витамин Е (токоферол)

является хорошим антиоксидантом, предотвращающим
разрушительные окислительные процессы в организме. Ученые доказали, что у 34,5% людей

наблюдается ускорение роста волос при приеме витамина Е в течение восьми месяцев.

Необходимые витамины для роста ребенка

Рост малыша определяется преимущественно генетически. Однако для правильного…


Рост малыша определяется преимущественно генетически. Однако для правильного и своевременного развития опорно-двигательного аппарата необходимы специальные вещества: витамины, микроэлементы и пр. С пищей поступает далеко не весь требуемый комплекс. Поэтому родителей часто интересует, какими витаминами для роста ребенка следует обзавестись. Большинство из них отдает предпочтение пищевой добавке Orthomol Junior C Plus. Она содержит важные для детского организма питательные вещества.

Витамины, способствующие активному росту и развитию

  • D – отвечает за всасывание фосфора и кальция, укрепляет кости и зубы, предотвращает появление рахита.

  • K – помогает костям расти активнее, снижает свертываемость крови, благодаря чему питательные вещества лучше усваиваются в организме.

  • C – его главная функция заключается в том, что он способствует всасыванию витаминов D, E, A, защищает их от свободных радикалов и разносит по тканям.

  • B1 – улучшает пищеварительный процесс.

  • B2 – отвечает за нормализацию обмена веществ, чем стимулирует рост скелета.

  • B6 – способствует правильному формированию костной системы.

  • Кальций – основа развития костей, именно от его количества в организме зависит интенсивность роста.

  • Йод – содержится в гормонах, вырабатываемых щитовидной железой. При нехватке этого компонента активность роста может существенно снизиться.

Все эти вещества, которые требуются для нормального развития, входят в состав указанной пищевой добавки. Также в ней содержатся железо, магний, цинк, биотин, фолиевая и пантотеновая кислота, медь и прочие элементы, положительно влияющие на рост детей.

Что еще имеет значение для развивающегося организма?

Прием пищевых добавок – отличный, но не единственный способ обеспечить полноценный рост. Для этого не менее важными являются:

  • Сбалансированное питание. Ограничьте употребление простых углеводов – они способны оказать прямо противоположный эффект. Обеспечьте присутствие в рационе белков, растительных жиров и пр. в достаточном количестве.

  • Физическая активность. Регулярные прогулки на свежем воздухе, спортивные занятия будут значительно полезнее, чем времяпрепровождение за компьютером.

  • Полноценный отдых. На сон следует выделять не менее 8 часов в сутки. Однако все зависит от конкретного ребенка: некоторым необходимо спать и по 10 часов.

  • Психологический комфорт. Сильные стрессы и нагрузки негативно отражаются на растущем организме. Если у вашего ребенка конфликты с товарищами или учителями, разберитесь в ситуации. Дома создайте благоприятную атмосферу, при необходимости проконсультируйтесь с детским или семейным психологом.

Выполнение вышеизложенных рекомендаций, а также прием специальных препаратов в комплексе обеспечат нормальный рост и гармоничное развитие малыша.

Выбрать подходящие витамины для вашего ребенка вы можете в нашем разделе витамины для детей

что нужно знать – Хорошие привычки

Ни для кого не секрет, что для нормального роста волос необходимо ежедневно потреблять ряд витаминов и микроэлементов. Полноценное питание волос позволяет сделать их более шелковистыми, здоровыми на вид, менее жирными, обеспечивает эффективную защиту от ломкости и выгорания под воздействием солнечных лучей.

Без каких витаминов для роста волос не обойтись

Самыми важными для роста волос традиционно считаются витамины группы В, в том числе В1, В2, В3, В5, В6, В9, В12. Баланс указанных витаминов в организме позволяет улучшить состояние кожи головы, активизирует обменные процессы в волосяных луковицах. При недостатке витаминов группы В возникают такие негативные явления, как перхоть, ломкость волос, сечение кончиков волос, волосы становятся блеклыми.

Интересно: Калорийность красной фасоли

Нельзя переоценить для роста волос важность витамина А. С помощью витамина А обеспечивается эффективная защита кожи головы от негативного воздействия свободных радикалов, интенсифицируется выработка кератина.

Для кислородного насыщения кожи головы и волосяных луковиц необходим витамин Е. При балансе в организме витамина Е волосы менее подвержены разрушению ультрафиолетом, защищены от болезнетворных организмов.

Для защиты кожи головы от дерматозов, пеллагры и дерматитов нужно ежедневно поддерживать баланс витамина РР. С помощью данного витамина создаются условия для нормальной работы всех слоев кожи головы, обеспечивается хорошее витание луковиц волос, активизируется в коже головы воздухообмен.

Источником незаменимых жирных кислот для волос традиционно остается витамин F. Именно благодаря ему кожа головы не сохнет, хорошо пропускает питательные вещества, белки, витамины.

Почему рекомендуют натуральные витамины для роста волос

Если вы хотите восстановить концентрацию в организме витаминов для роста волос, лучше выбирать натуральные источники поступления, а не химические продукты и средства. Большинством проведенных научных исследований доказано, что минералы и витамины для интенсивного роста лучше всего получать с пищей, а не в форме добавок, таблеток, различных настоек с витаминными комплексами.

Интересно: Калорийность цикория

У каждого организма есть свой определенный темп всасывания витаминов и минералов, который не нарушается только в том случае, когда полезные вещества в организм попадают в естественных концентрациях. Если вы начнете потреблять больше продуктов с указанными выше витаминами, то можете быть уверены, что большая часть минералов и питательных веществ пойдет в дело. С другой стороны, использование насыщенных витаминами для роста волос комплексов становится своеобразным стрессом для организма: он не привык усваивать в таких концентрациях полезные вещества и из-за стресса активизирует защитные реакции, усиленно выводя «лишние» питательные вещества.

При использовании искусственных добавок и таблеток с витаминами для роста волос очень важно соблюдение принципов нормированности и постепенности. В противном случае вы просто выкинете деньги на ветер и не принесете своим волосам никакой пользы.

Не следует забывать про том факт, что ненатуральные витаминные комплексы насыщены (а в случаях недобросовестных изготовителей даже перенасыщены) различными химическими веществами-активаторами, ускоряющими всасывание и обменные процессы в волосяных луковицах и коже головы. Думаю, никому не нужно объяснять, что химия в организме – всегда вредно.

В чем содержатся витамины для роста волос

Если вы сделали выбор в пользу натуральных витаминов для роста волос, рекомендуем вам внести ряд изменений в свой рацион питания. Очень важно ежедневное потребление в повышенных количествах животных и растительных белков. Несомненную пользу для активного роста волос несут соя, орех и яйца; активизируют работу волосяных луковиц шиповник, свежие фрукты, овощи, мед, оливковое масло. Зимой следует добавить в меню овсяную кашу, сельдь, кислую капусту.

Интересно: Калорийность оливок

Здоровый вид волос обеспечит ежедневное питье 1,5 – 2 л чистой воды. Вода делает волосы более живыми, замедляет их выгорание на солнце, нормализует жирность волос.

Красота и здоровье ваших волос в ваших руках — Наука. Природа. Медицина. Образование — Культура ВРН

  • Текст: Анна Домина
  • Фото: mrtop.ru

Красивые и здоровые волосы могут стать украшением любого человека. Но очень часто из-за плохой экологии, постоянных стрессов, неправильного питания и других негативных факторов состояние волос может ухудшаться. Они становятся ломкими, кончики секутся и начинают выпадать. Иногда выпадение волос становится настоящей проблемой.

Чтобы восстановить волосы недостаточно лишь использовать укрепляющие маски и другие средства. Необходимо укреплять здоровье волос изнутри, употреблять специальные витамины от выпадения волос. Таким образом вы сможете укрепить ваши волосы, они станут более здоровыми.

Преимущества употребления витаминов


Мать-природа позаботилась о нас и создала естественные наполнители важных микроэлементов и витаминов для нашего здоровья и долголетия. В разнообразных продуктах содержится всё самое необходимое для нашего полноценного функционирования. Но иногда мы неправильно питаемся, и организм недополучает важных элементов и витаминов. Либо мы всё нужное употребляем, но качество самих продуктов оставляет желать лучшего. Именно тогда на помощь приходят витамины. Преимущества готовых витаминов заключаются в следующем:

• вы точно знаете, какие витамины употребляете;
• удобно брать с собой;

• даже если вы на диете или на пп, вы точно будете знать, что ваш организм получает все самое необходимое;
• хороший результат. Регулярное употребление витаминов для волос сделает их более крепкими, а выпадать они станут меньше.

Витамины каких групп нужны для волос


Для активного роста волос нужны следующие витамины:

• витамин А. Он способствует регенерации кожи, снижает шелушение. Помните, что дефицит этого витамина может приводить к усиленному выпадению волос, а также его избыток может негативно влиять на здоровье волосянных луковиц;

• витамин В также чрезвычайно важен для волос. Зачастую рекламодатели упоминают название этого витамина в своей продукции по уходу за волосами. Витамин В12 содержится в продуктах животного происхождения. Поэтому если вы веган или вегетарианец, то вам непременно стоит дополнительно принимать этот вид витамина;

• витамин С участвует в синтезе коллагена, что также чрезвычайно важно для красоты наших волос. Он способствует усвоению железа, что питает наши волосы, благодаря правильной работе фолликулов;

• витамин Е является хорошим антиоксидантом, препятствует возникновению окислительных процессов;

• железо и цинк, благодаря которым волосы эластичные и живые.

Как видим, для здоровья волос очень важны разные витамины. Пополните запасы вашего организма при помощи биологически активных добавок.


Партнёрский материал

Витамины для ногтей, волос и кожи: как выбрать

Чем витамины для кожи отличаются от традиционных поливитаминных комплексов? Благодаря своей формуле такие препараты целенаправленно воздействуют на кожу, улучшая ее состояние и внешний вид. «В этом их основное отличие — они учитывают, в первую очередь, именно ее потребности, — говорит Юлия Бастригина, врач-диетолог, эксперт бренда Nutrilite. — Кожа — это ткань с очень высокой скоростью обновления и, соответственно, довольно высокими потребностями в структурных и регулирующих ее состояние веществах. Поэтому витамины красоты могут содержать необычные для других комплексов компоненты, например, церамиды или комплекс аминокислот». Скажем сразу, что препараты, которые производитель позиционирует как «витамины для волос», фактически тоже работают с кожей (скальпом). Ведь от состояния кожи головы зависит и состояние волос — их сухость / жирность, здоровый блеск, выпадение и т.д.

Состав витаминов красоты

Как правило, основу таких комплексов составляют витамины группы В, витамины С, А, и Е.

  • Витамины группы В оказывают на кожу комплексное воздействие: ускоряют обмен веществ, способствуют восстановлению, защищают от агрессивного воздействия внешней среды. Дефицит витаминов группы В провоцирует развитие различных дерматитов.
  • Витамин С (аскорбиновая кислота) — один из главных борцов с фотостарением кожи. Он особенно важен для тех, кто проводит много времени на свежем воздухе. И для тех, кто постарше: витамин С принимает активное участие в образовании коллагена, делает кожу более упругой.
  • Витамин А (ретинол) нередко так и называют «витамином красоты». Он принимает участие в процессах восстановления и обновления, от него во многом зависит синтез коллагена. Ретинол устраняет шелушение и нормализует пигментацию. Он есть едва ли не в каждом адресованном коже комплексе витаминов.
  • Витамин Е защищает липидный слой кожи и противостоит воздействию свободных радикалов. Значительно ускоряет процесс обновления клеток. Как и витамин С, активно борется со старением, вызванным солнечной радиацией.

«Более продвинутые версии витаминов красоты дополняются ценными растительными антиоксидантами, цинком, церамидами, полиненасыщенными жирными кислотами, фитоэстрогенам и фитонутриентами, — говорит Юлия Бастригина. — Такой усиленный состав — гарантия того, что препарат будет работать максимально эффективно».

Кроме фитоэстрогенов в витаминные комплексы могут входить и биоактивные вещества, например, полученные из плаценты, из продукции пчеловодства, альгинаты из морских водорослей, растения, обладающие регенеративными свойствами типа алоэ, облепихи.

«Витамины красоты» нередко содержат и коллаген — строительный материал для обновления тканей, органические соединения серы, которые участвуют в создании структуры коллагеновых волокон, уменьшают отечность, улучшают циркуляцию, — говорит Наталья Фадеева, диетолог-эндокринолог клиники семейной диетологии «МЕДЭП». — Из микроэлементов также часто входят в состав таких комплексов селен и марганец, которые в сочетании витамином Е и С, помогают полноценному формированию и сохранению упругости соединительной ткани кожи».

Когда начинать прием

Обычно мы начинаем активно ухаживать за кожей при появлении первых признаков ее старения — после 25 лет или даже ближе к 30. «И это не совсем правильно, — говорит Юлия Бастригина. — Не будем забывать, что профилактика всегда эффективнее лечения. Поэтому начинать питать свою кожу изнутри можно уже с 18-19 лет. А если она проблемная — сухая и обезвоженная или, наоборот, отличается повышенной жирностью — принимать поливитаминные комплексы можно и раньше. Но в этом случае желательно посоветоваться с врачом. Специалист точно определит, в чем именно нуждается ваша кожа, и подберет препарат, максимально отвечающий ее потребностям».

Если параллельно со специальным комплексом вы принимаете другие поливитамины, будьте осторожны. «При приеме витаминных препаратов принцип «чем больше, тем лучше» не приемлем, — говорит Юлия Бастригина. — Передозировка одноименных витаминов небезопасна. Если у поливитаминных комплексов слишком много совпадений, от параллельного приема необходимо отказаться или сократить дозировку». Следует заметить, что самостоятельно составить грамотную комбинацию поливитаминных препаратов трудно. Поэтому лучше проконсультироваться со специалистом.

Перед тем как принимать любые витаминно-минеральные комплексы, по словам Натальи Фадеевой, желательно сделать анализ волос или ногтей на микроэлементный состав, а также анализ крови на витаминный состав, так будет легче сориентироваться по выраженным дефицитам и избежать передозировки каких-либо из витаминов. Сейчас такие анализы предлагают многие лаборатории.

Принимайте витамины красоты правильно

Поливитаминные комплексы, предназначенные специально для кожи, как, впрочем, и любые другие, принимают курсами. «Срок — от 15 до 60 дней с перерывом между курсами в 2-3 месяца, — рассказывает Юлия Бастригина. — Длительность курса зависит от возраста: чем больше вам лет, тем дольше рекомендуется пить витамины, так как возрастная кожа обновляется значительно медленнее, чем молодая. Таки е препараты отличаются временем приема: кожа обновляется в основном в ночные часы, поэтому пить витамины красоты следует ближе к вечеру».

«Уповать лишь на «витамины красоты» все же не стоит, — говорит Наталья Фадеева. – Они должны быть просто дополнением к здоровому образу жизни. Если продолжать несбалансированно питаться и употреблять алкоголь, это неизбежно приведет к витаминодефициту. Курение нарушает кровообращение кожи из-за спазма сосудов и приводит к хронической интоксикации. Сидяцая работа и малоподвижный образ жизни мешают нормальной циркуляции крови и лимфы, что нарушает питание клеток и витамины просто не попадают, туда куда нужно. Таким образом, прием витаминов красоты может стать абсолютно не эффективным мероприятием. Очень важно также избегать стрессов!. В этом случае организм будет использовать все витамины и микроэлементы на борьбу со стрессом, и ему будет не до красоты».

Имейте в виду, что витамины для кожи, как и другие комплексы могут вызывать аллергию. В таком случае от препарата лучше отказаться.

Пищевые добавки для волос

К биологически активным добавкам (БАДам) стоит присмотреться тем, кто не доволен состоянием своих волос — усиленным выпадением, истончением, ломкостью и т.п. «Если в принципе особых проблем нет, но вам хочется, чтобы волосы росли быстрее, стали объемнее и крепче, тоже будет не лишним дополнить рацион соответствующей пищевой добавкой, — говорит Денди Энгелман, врач-дерматолог Центра медицинской дерматологии и косметической хирургии в Нью-Йорке. — Когда вы принимаете препарат, его активные компоненты попадают в кровяное русло и питают все клетки организма, включая волосяные фолликулы. Волосы любят протеин, железо, цинк, витамин В 12 — вещества, которые поддерживают их структуру, стимулируют рост, увлажняют кожу головы. Если вы не получаете эти важные компоненты в достаточном количестве из продуктов питания, прием пищевых добавок поможет решить проблему». Среди других необходимых для здоровья и красоты волос элементов — витамин А, другие витамины группы В, омега-3 жирные кислоты, селен, магний и витамин D.

Если вы когда-нибудь пробовали покупать БАДы для волос, вероятно, вы были ошеломлены разнообразием подобного рода средств. Как выбрать то, что действительно будет работать? Внимательно читать этикетки, проверяя, есть ли в составе средства компоненты с доказанной эффективностью. Не лишним будет также спросить совет специалиста, особенно если по той или иной причине вы вынуждены принимать лекарства.

Какие же вещества на самом деле полезны нашим волосам? Вот список компонентов, наличие которых может быть свидетельством того, что перед вами пищевая добавка, на которую стоит потратиться.

  • Биотин — это водорастворимый витамин В. Биотин, принимая активное участие в расщеплении жиров и углеводов, стимулирует рост волос, а также улучшает состояние кожи и ногтей. БАДы на основе биотина рекомендуется принимать при усиленном выпадении волос, их истончении. Витаминный комплекс с биотином часто содержит еще и такие компоненты, как цинк, витамин С, железо и экстракт хвоща. Такой состав продлевает фазу активного роста волос — стадию анагена. По результатам исследования 2015 года, которые были опубликованы в журнале Dermatology Research and Practice, женщины, принимавшие один из таких препаратов, через три месяца отмечали, что их волосы стали более объемными и стали меньше выпадать.
  • Ашваганда — этот растительный экстракт помогает контролировать синтез в организме кортизола — гормона стресса, который может способствовать усиленному выпадению волос.
  • Аминокомплекс — белки, являющиеся строительным материалом для кератина, — вещества, из которого большей частью состоит волосяной стержень.
  • Витамины С, А и Е — мощные антиоксиданты, которые помогают клеткам бороться со свободными радикалами повреждающими волосяные фолликулы.
«Ищите БАД с высокой концентрацией компонентов, которые активно воздействуют на волосы в каждой фазе их роста, — говорит наш эксперт. — Положительный эффект от приема качественной пищевой добавки наступает уже через 3-6 месяцев».

Как остановить выпадение волос осенью: все, что нужно знать

По запросу «выпадение волос осенью» услужливый поисковик Google выдает больше 2,5 миллионов ссыллок. Это значит, что проблема беспокоит многих девушек во время смены сезонов. Хотя, казалось бы, с чем может быть связано выпадение волос после летнего сезона, на который выпадает львиная доля витаминов и отпусков — а значит, качественного отдыха и минимум стресса.

Между тем, все не так просто: например, в преддверии сезона купальников многие в попытке обрести фигуру мечты, и садятся на жесткие монодиеты, исключая множество продуктов из рациона. К осени подобная беспечность откликается выпадением.

Или, например, на отдыхе у вас было тяжелое отравление, которое нарушило микрофлору кишечника и стало причиной ослабления волос. Следует помнить, что причину нужно искать не «вчера», а гораздо раньше. Почему?

Дело в том, что густота, текстура и толщина волос зависит от диаметра волосяной луковицы. В фолликулах происходит деление клеток, которые и формируют волосок.

За нормальное протекание этого процесса отвечает особый ген — EDAR. Чем выше скорость деления клеток в луковице, тем гуще и толще будут локоны.

Отдельные волосы появляются, растут и выпадают в соответствии с независимым жизненным циклом, состоящим из следующих фаз:

Фаза анагена

Это фаза активного роста, самый продолжительный период жизненного цикла волос, который в среднем длится от 2 до 7 лет. Большинство наших волос находится в фазе анагена.

Фаза катагена

Переходная фаза, которая характеризуется окончанием этапа анагена и переходу к фазе телогена. В это время волосы перестают расти, но еще не выпадают. Эта фаза длится около трех недель.

Фаза телогена

Во время фазы телогена волосы больше не растут и выпадают, а на их месте начинают развиваться новые. Эта фаза длится около трех месяцев.

Если жизненный цикл волос нормальный, их процент в фазе анагена составляет от 85 до 90%, к фазе катагена относится примерно 1% и около 10-15% находится в фазе телогена. Однако, в течение жизни, у мужчин и женщин по разным причинам жизненный цикл волос может меняться.

Причинами таких изменений могут быть смена сезона, усталость, стресс, гормональный дисбаланс (беременность, менопауза), плохой уход за волосами, неправильное питание, лекарства, влияющие на состояние волос, экология, возрастное выпадение волос.

В этом случае процент волос в фазе анагена может упасть ниже 80%, а доля волос в фазе телогена может возрасти и составить более 20%.

Тогда выпадение волос становится чрезмерным. Происходит такое ненормальное выпадение, прежде всего, из-за ослабления структуры волос.

Кроме того, причиной резкого ухудшения качества волос могут быть: ультрафиолетовое излучение, которое влияет и на структуру волос, и на кожу головы, соленая морская и хлорировання вода в бассейнах, горячий воздух, песок, отказ от использования специальных hair-средств с SPF и ношения шляпы или платка в полдень, которые оберегают пряди от палящих солнечных лучей.

Лена Лисун узнала экспертное мнение о сезонном выпадении волос у члена Ассоциации трихолого Украины, специалиста по реабилитации волос и кожи головы с 13-летним стажем Юлии Седлецкой:

«Во время летнего периода организм насыщается полезным воздействием солнца, витаминов и отдыха. При этом, как показывает статистика и  практики, девушки намного довольнее собой именно в теплый сезон, и поэтому меньше ухаживают за волосами. Вместе с наступлением первых прохладных дней это проходит. Девушки обнаруживают: в солнечных лучах  и морской воде локоны были красивыми и блестящими, а сейчас стали слишком ломкими, а количество волос на расческе выходит за пределы нормы.

Мои рекомендации для диагностики и борьбы с сезонным выпадением такие: в первую очередь необходимо уже в августе-сентябре сдать анализы на самые важные микроэлементы для здоровья ваших волос. Всегда помните, что здоровье волосы является отображением наших внутренних состояний организма. Существует список базовых витаминов, баланс которы должна контролировать каждая девушка.

К ним относятся: витамин D, йод, железо (общий феритин), а также такие важные элементы, как Омега-3,6,9, которые влияют на состояние кожи.

Не забывайте, что наши волосы — это клетки кожи головы. Чтобы они формировались и росли блестящими, наполненными — необходима здоровая и увлажнённая кожа головы.

Также очень важно знать, что волосы — это белки (аминокислоты), и дефицит этого вещества неизменно будет приводить к формированию ломкого волоса. В течение года я рекомендую дважды проходить  3-месячный месяцев курс в виде витаминных комплексов, в которых есть такие аминокислоты, как L-цистеин и L-карнитин. А в сочетании с витаминами группы В ваши волосы всегда будут радовать вас густотой и эластичностью».

Действительно, проведенное в Германии в 2000 году исследование показало: комбинация L-цистеина, пантотеновой кислоты и экстракта семян проса улучшает рост волос у женщин с диффузным выпадением волос.

У этой категории женщин значительно увеличилось количество прядей волос по сравнению с участниками, которые принимали плацебо.

Эти необходимые питательные вещества для укрепления и активного роста волос содержатся в витаминно-минеральном комплексе Orthomol Hair Intense. В нём объединены важные микроэлементы, витамины группы B с аминокислотами L-цистеин и L-метионин, а также запатентованный экстракт проса KeraLiacin и милиацин.

Милиацин — это тритерпеноид, который в настоящее время обнаруживается только в просе Panicum miliaceum. Милиацин впервые был изучен на предмет его лечебных свойств и его активности в отношении клеточной пролиферации. В течение длительного времени он используется в пищевых добавках, предназначенных для ухода за волосами и здоровья. Милиацин — единственный натуральный ингредиент, содержащийся в просе. Специальный процесс инкапсуляции полярными липидами обеспечивает его улучшенное всасывание в организм.

Аминокислота L-цистеин является одним из основных строительных блоков кератина, волокнистого белка, который составляет структуру кожи, ногтей и волос.

Без достаточного количества L-цистеина волосы ослабнут и будут склонны к ломкости. L-цистеин подавляет окислительный стресс, вызванный курением, употреблением алкоголя и воздействием вредных металлов. L-метионин является предшественником L-цистеина и играет важную роль в метилировании генов. L-цистеин необходим для того, чтобы помочь организму усваивать определенные питательные вещества, включая биотин (витамин B7), который является важным питательным веществом для роста волос.

Кроме этих полезных ингредиентов, в составе комплекса Orthomol Hair Intense есть биотин, цинк и селен для поддержания роста локонов, медь для пигментации волос, цинк, селен и медь для защиты клеток от окислительного стресса, тиамин (витамин B1), витамин B6, витамин B12, биотин, пантотеновая кислота, которые способствуют нормальному энергетическому обмену.

В завершении Лена Лисун делится лайфхаком для истинных beauty-гурманов. Чтобы сделать волосы более гладкими, противостоять обламыванию и уменьшить количество механических повреждений, обзаведитесь шелковой наволочкой для подушки. Это не только бесценная инвестиция в ваш hair-уход, но и очень эстетичная деталь интерьера, утренние селфи на которой соберут сотни лайков. 


Витамины для роста волос

Для активного роста нужны витамины. Для какого роста? Для любого, ведь каждая деталька вашего организма растет, пусть даже и незаметно для людского глаза. Вот для этого процесса нужны витамины.

Сейчас речь пойдет о тех витаминах, которые способствуют хорошему росту волос.

Витамин А или ретинол делает волосы эластичными, восстанавливает структуру волос, борется с сухостью и выпадением. Им богаты желтые и зеленые фрукты и овощи, сливочное масло, яичный желток, печень рыб, морковь, крыжовник, курага.

Витамины группы В отвечают за рост волос, а также делают их блестящими и прочными. Витамин В12, В6 и В1 ускоряют рост волос, В2 делает их здоровыми, В5 и В3 необходимы для роста волосяных фолликул, В8 препятствует выпадению, а В9 помогает при облысении и седине. Эти витамины содержатся в избытке в крупах, орехах, яйцах, моркови и фасоли.

Витамин Е – также хороший витамин для роста волос, который улучшает циркуляцию кислорода в крови. Этот витамин незаменим для тех, кто мечтает отрастить длинные волосы. Он содержится в растительном масле, семечках и орехах.

Витамин С отвечает за рост волос и помогает избежать их выпадения, так как отлично стимулирует кровообращение и укрепляет волосяные фолликулы. Им богата капуста, цитрусовые, шиповник, перец, смородина и киви.

Биотин или витамин Н – очень полезный витамин для роста волос, который также укрепляет их структуру. Им богаты бобовые, орехи, соя, геркулес, пивные дрожжи.

Микроэлементы для роста волос:

Цинк и медь предотвращают облысение и способствуют быстрому росту волос. Содержатся в креветках, бобах, печени, грецких орехах и купах.

Железо делает волосы более крепкими, предотвращая ломкость. Им богаты печень, желтки и орехи.

Сера укрепляет стержень волоса и улучшает цвет. Содержится в чесноке, рыбе и печени.

Молибден ускоряет рост волос. Им богаты какао, печень и почки животных, горох.

Кремний делает волосы упругими и сильными, улучшает их рост. Им богаты крупы и корнеплоды.

Метилсульфонилметан (MSM) – это новое необычайно эффективное вещество, которое прописывают для быстрого роста волос и их восстановления.

Как мужчины становятся более густыми с помощью пищевых добавок? – Магазин Face Med

Залысины, видимое выпадение волос и истончение волос — вот некоторые из проблем, которые беспокоят мужчин из-за их внешности. В то время как большинство мужских проблем с волосами приходят с возрастом, некоторые люди страдают от выпадения волос из-за андрогенетической алопеции, состояния гормонального дисбаланса, которое вызывает сокращение волосяного фолликула. К счастью, существуют средства по уходу за волосами и процедуры, которые могут помочь справиться с выпадением волос у мужчин.

Итак, как мужчины могут сделать волосы более густыми с помощью пищевых добавок? Добавки для ухода за волосами работают, гарантируя, что вы получаете достаточное количество витаминов и питательных веществ, необходимых для поддержания здорового роста волос.Лучшая формула для роста волос содержит необходимые биотиновые добавки, железо, цинк и витамины для волос D, C и E, которые могут помочь сохранить здоровую кожу головы и сильные фолликулы, чтобы предотвратить истончение волос.

Все питательные вещества и витамины, в которых нуждаются ваши волосы, в одном укусе. Получите жевательные резинки для волос сегодня по номеру
со скидкой 20% по номеру с «20OFF» !

Чем здоровее ваша кожа головы, тем здоровее ваши волосы. Боритесь с выпадением и истончением волос с помощью этой идеальной жевательной смеси витаминов и минералов, которую можно купить в FACE Med Store со скидкой 20% на первый заказ!

Код купона активен только для зарегистрированных пользователей.

Здесь вы можете создать учетную запись.

МАГАЗИН

Причины выпадения волос и роль добавок для роста здоровых волос

Выпадение волос у мужчин и женщин может быть вызвано множеством факторов, таких как стресс, побочные эффекты лекарств, ранее существовавшие заболевания или состояния здоровья, дефицит витаминов и гормональные изменения. У некоторых также могут быть проблемы с кожей головы или выпадением волос, которые нарушают цикл роста волос и приводят к симптомам выпадения волос. Наиболее распространенные причины выпадения волос: 

  • Телогеновая алопеция: это тип выпадения волос, при котором большее количество волосяных фолликулов остается в телогене или фазе покоя и задерживает начало анагена или фазы роста.Люди с этим заболеванием часто наблюдают выпадение волос на голове.
  • Андрогенная алопеция: Также известная как облысение по мужскому типу, говорят, что большинство мужчин страдают от выпадения волос из-за этого состояния. У женщин это известно как облысение по женскому типу и сопровождается значительным истончением волос на голове.
  • Очаговая алопеция : эта форма выпадения волос вызвана аутоиммунным заболеванием, при котором иммунная система организма воздействует на здоровые ткани кожи головы.Это часто приводит к самопроизвольному выпадению значительного количества прядей волос, что оставляет видимые пятна.

Секрет здорового роста волос заключается в том, чтобы ежедневно получать достаточное количество белков и питательных веществ, необходимых для роста и укрепления волос. С точки зрения производства волос, организму необходимо достаточное количество аминокислот для создания кератина, который является наиболее важным структурным белком волос. Дефицит кератина часто приводит к потере густоты и объема волос.

Преимущества приема добавок от выпадения волос

Употребление в пищу продуктов с высоким содержанием витаминов и аминокислот помогает поддерживать волосяные фолликулы и стимулировать здоровую регенерацию волос, предотвращая их выпадение и истончение. Но помимо соблюдения полноценной диеты, вы также можете принимать пищевые добавки для ухода за волосами. Сочетание здорового питания и приема добавок для волос поможет вам отрастить более густые и густые волосы.

Вот некоторые из преимуществ витаминов для роста волос и добавок по уходу за волосами: 

  • Может способствовать более быстрой и сильной регенерации волос : Научные исследования по уходу за волосами показывают, что добавки для волос могут стимулировать новые клетки, способствуя росту волос.Пищевые добавки для волос также обеспечивают хорошее кровообращение, доставляя важные питательные вещества, которые помогут отрастить здоровые и густые волосы.
  • Замедляет старение волос и предотвращает их истончение: Как и кожа, волосы и кожа головы подвержены воздействию свободных радикалов из окружающей среды. Свободные радикалы быстрее старят волосы и теряют блеск, цвет и густоту. Добавление большего количества витаминов в ваш организм может бороться с этими радикалами и повысить защиту кожи головы, чтобы сохранить волосы здоровыми.
  • Поддерживает существующие волосяные фолликулы активными : Волосяные фолликулы в первую очередь отвечают за обновление здоровых клеток, стимулируя регенерацию волос. Они играют важную роль в цикле роста волос, и обеспечение функционирования фолликулов является одним из преимуществ добавок для волос. Есть много продуктов для волос и витаминов, которые гарантируют, что ваше тело вырабатывает сальные железы, чтобы поддерживать смазку фолликулов, чтобы они могли продолжать расти волосы на коже головы.
  • Улучшает густоту волос и восстанавливает их здоровый вид: Мужчины с проблемами волос также могут заметить, что их волосы потеряли свой блеск и теперь выглядят тусклыми и сухими.Добавки для волос могут восстанавливать волосы изнутри, гарантируя, что кожа вокруг фолликулов вырабатывает натуральные масла для увлажнения волос. Он также поддерживает рост более густых и полных волос, чтобы справиться с проплешинами, а также решить проблему истончения волос.

Что делает добавку для роста волос эффективной?

Что делает пищевые добавки для роста волос эффективными, так это их эффективная и мощная формула. Большинство доступных витаминов для ухода за волосами содержат ключевые ингредиенты, которые необходимы, чтобы вернуть жизнь коже головы и стимулировать активное производство волос.Вот некоторые из основных витаминов в продукте для роста волос:

1. Биотин или витамин B7

Биотин является важным строительным материалом для белков, который поддерживает здоровье волос и укрепляет ногти. Он необходим для добавок по уходу за волосами, так как считается, что он помогает увеличить скорость роста фолликулов, играя активную роль в создании кератина. Говорят, что люди с дефицитом биотина более уязвимы к слабому росту волос и активному выпадению волос. Прием биотина может помочь волосам расти быстрее и укрепить пряди.

2. Цинк

Цинк — еще один важный витамин для волос, который поддерживает рост и восстановление волосяных тканей, а также поддерживает здоровье волосяных фолликулов. Недостаток цинка может способствовать легкому повреждению и выпадению волос, что может привести к серьезным проблемам с их выпадением. Важно убедиться, что вы получаете суточную дозу цинка из пищевых добавок и диеты. Одними из лучших источников цинка являются продукты с высоким содержанием белка, такие как мясо, птица, морепродукты и шпинат.

3.Железо

Железо помогает доставлять кровь и кислород к корням волос, чтобы они могли поддерживать активный рост волос. В некоторых случаях у людей с дефицитом железа диагностируют анемию, которая также вызывает появление симптомов выпадения волос. Вы можете получать железо из пищевых добавок, а также из пищевых продуктов, таких как бобы, тыквенные семечки и красное мясо.

Представляем PEP Scalp, неинвазивную альтернативу PRP, состоящую из белков, богатых пептидами. Получите
Скидка 20%   Ваша корзина с «СКИДКА 20»!

Специально разработанный для кожи головы, PEP Scalp является новаторской альтернативой PRP-терапии для омоложения волос и кожи головы.Это помогает пациентам достичь аналогичных результатов без необходимости вкладывать средства в центрифугу.

Код купона активен только для зарегистрированных пользователей.

Здесь вы можете создать учетную запись.

МАГАЗИН

4. Витамин D

Витамин D поддерживает рост здоровых волос, создавая новые волосяные фолликулы. Это может помочь сохранить толщину волос и сохранить существующие пряди волос, чтобы они не выпали преждевременно. Рекомендуется получать суточную дозу витамина D от 1000 до 2000 МЕ, чтобы сохранить кожу, волосы и тело здоровыми.

5. Витамин С

Витамин С способствует регенерации клеток и стимулирует выработку коллагена для поддержки фолликулов и общей структуры волос. Они также являются отличным антиоксидантом и защищают от свободных радикалов, которые могут вызвать раннее старение и истончение волос. Прием витамина С также помогает вашему организму усваивать минералы и железо, что способствует хорошему росту более густых волос.

6. ​​Витамин Е

Витамин Е также обладает антиоксидантными свойствами, которые способствуют здоровой коже головы и сильным волосам.Он также уменьшает количество окислительного стресса от свободных радикалов и предотвращает разрушение клеток, которое может вызвать симптомы выпадения волос. Это также хорошо для поддержания влажности волос и помогает контролировать выработку масла в коже головы.

Другие средства для лечения роста и выпадения волос у мужчин

Помимо назначения добавок по уходу за волосами, врачи и дерматологи могут порекомендовать специализированные процедуры по уходу за волосами при ваших симптомах. Вот некоторые из распространенных методов лечения выпадения волос:

  • Лекарства : Миноксидил — распространенное лекарство от выпадения волос, доступное в виде жидкости и пены.Это утолщающий шампунь, который наносится на кожу головы и помогает отрастить волосы и замедлить их выпадение. Другим известным средством от выпадения волос является финастерид, который представляет собой пероральное лекарство, отпускаемое по рецепту, для стимуляции роста волос.
  • Лазерная терапия: Низкоинтенсивное лазерное лечение также рекомендуется для улучшения густоты и густоты волос у тех, кто страдает от истончения волос. Теория, лежащая в основе этого лечения волос, заключается в том, что оно уменьшает воспаление волосяных фолликулов, чтобы стимулировать увеличение роста волос.
  • Массаж головы : Массаж кожи головы помогает стимулировать волосяные фолликулы и увеличивает приток крови к коже головы. Это обеспечивает улучшенные результаты густоты волос и уменьшает вероятность выпадения волос.
  • Сыворотки для местного ухода за волосами: Медицинские продукты для волос, такие как PEP Factor, сегодня также используются многими косметологами. Продукты PEP Factor содержат различные пептиды, питательные вещества и факторы роста, которые могут помочь в омоложении волос и кожи головы. Также говорят, что он поддерживает рост коллагена, стимулируя фибробласты, чтобы сохранить здоровье фолликулов.

Откройте для себя PEP Factor и другие средства для омоложения волос в магазине Face MED сегодня

Соблюдение сбалансированной диеты, богатой здоровой пищей и добавками, является мудрой практикой для поддержания здоровья волос. Тем не менее, по-прежнему важно, чтобы косметологи знали, когда рекомендовать лечение выпадения волос, такое как PEP Factor, для эффективного лечения проблем с кожей головы и волосами.

В FACE Med Store мы предоставляем высококачественные медицинские товары и инструменты для омоложения волос для многих косметических и оздоровительных практик.Мы предлагаем продукты PEP Factor по доступным ценам, чтобы вы могли расширить услуги своей клиники и лучше предлагать клиентам эстетический уход и лечение. Узнайте больше о наших продуктах, чтобы добавить их в свой каталог, и свяжитесь с нами сегодня.

Pep Factor: идеальная смесь для улучшения здоровья кожи головы и кожи

Дайте своим пациентам бодрящий фактор из FACE Med Store и предоставьте им уникальную альтернативу для укрепления здоровья кожи и кожи головы.

МАГАЗИН

Три лучших витамина для местного лечения выпадения волос — Генри Тианус

 

«Недавнее исследование (Dermatologic Therapy, 2020) предполагает, что пантенол (провитамин B5) эффективен для лечения андрогенной алопеции.»

 

Исследования показали, что хроническое воспаление и окислительный стресс являются основными причинами всех типов выпадения волос, включая андрогенную алопецию. Помимо финастерида и миноксидила; кофеин, витамины и эфирные масла могут эффективно использоваться для предотвращения и уменьшения выпадения волос. Некоторые витамины, особенно витамин B3, витамин E и провитамин B5, обладают прекрасным противовоспалительным и антиоксидантным действием на волосяные фолликулы и кожу головы.

3 лучших витамина для местного лечения выпадения волос

1.Витамин B3

Исследования показали, что витамин B3 улучшает кровообращение и уменьшает воспаление кожи головы. Кровь переносит кислород и питательные вещества, чтобы поддерживать активность волосяных фолликулов. Плохое кровообращение приводит к тому, что волосяные фолликулы сжимаются и становятся спящими. Спящие волосяные фолликулы не могут вырастить волосы. Витамин B3 также предотвращает выпадение волос, уменьшая воспаление кожи головы. Так же, как плохое кровообращение, воспаление является одним из основных факторов выпадения волос. Воспаление вызывает повреждение волосяных фолликулов.Он ослабляет корни волос и вызывает выпадение волос.

Наилучшей формой витамина В3 является ниацинамид. В отличие от ниацина, который может вызывать раздражение, ниацинамид оказывает успокаивающее действие, поэтому подходит даже для чувствительной кожи головы. Ниацинамид является одним из ключевых ингредиентов средства от выпадения волос для мужчин и женщин . Эти синергетические формулы для омоложения волосяных фолликулов активируют спящие волосяные фолликулы, уменьшают выпадение волос и помогают обратить вспять влияние дигидротестостерона на цикл роста волос.

  

«Мой пациент с выпадением волос, который неделю назад начал использовать средства против выпадения волос Генри Тиануса, пришел в мою клинику и сказал мне, что продукты Генри Тиануса ФАНТАСТИЧЕСКИЕ. Его волосы уже выглядят здоровее и сильнее.»

др. Агустин Бланш  узнать больше >>>

  

2. Витамин Е

Исследования показали, что существует тесная связь между окислительным стрессом и выпадением волос. Окислительный стресс может вызвать хроническое воспаление кожи головы, что приводит к сильному выпадению волос.Люди, которые страдают от выпадения волос, обычно имеют более низкий уровень антиоксидантов в коже головы. Витамин Е научно известен как один из лучших антиоксидантов. Витамин Е нейтрализует свободные радикалы и защищает волосяные фолликулы от окислительного стресса.

Одной из лучших форм витамина Е является токоферилацетат, обладающий стабильной молекулярной структурой и высокими антиоксидантными свойствами. Токоферилацетат является одним из ключевых ингредиентов Scalp Stimulator , активатора корней волос перед шампунем для истончения волос.

 

» После того, как я использовала так много продуктов на рынке, я попробовала этот продукт. Прошло уже два месяца, и я вижу рост волос. Я нашел продукт идеальным. Служба поддержки клиентов великолепна. Они всегда на связи и профессионально ответят вам. 100% рекомендуемые.»

Амир подробнее >>>

 

3. Провитамин B5

Провитамин В5, также известный как пантенол, уже давно используется во многих формулах по уходу за волосами.Недавнее исследование показывает, что пантенол эффективен для лечения андрогенной алопеции, наиболее распространенного выпадения волос как у мужчин, так и у женщин. Было показано, что пантенол повышает активность восстановления клеток в волосяных фолликулах, предотвращает воспаление и окислительный стресс в коже головы. Он также укрепляет структуру волос и предотвращает ломкость и ломкость. Пантенол является одним из ключевых ингредиентов сыворотки для роста волос . Эта сыворотка, стимулирующая рост волос, способствует росту новых волос и уменьшает их выпадение.

 

«Я использовал сыворотку (для роста волос) каждый день в течение 30 дней, и выпадение волос прекратилось».

Дебра S узнать больше >>>

  

Автор:

Генри Тианус — удостоенный множества наград специалист по борьбе со старением из Лондона, Великобритания. Генри Тианус внесен в список признанных практикующих врачей Института традиционной фитотерапии и ароматерапии (ITHMA) в Лондоне (Великобритания) с 2005 года.Статьи Генри Тиануса были прочитаны людьми в более чем 100 странах, США и Великобритания возглавляют список. Подпишитесь на электронный информационный бюллетень Генри Тиануса, чтобы получать последние советы по здоровью и благополучию.

 Нажмите, чтобы присоединиться к электронному бюллетеню Генри Тиануса >>>  

 

Научные источники:  Ниацинамид снижает экспрессию DKK-1 и защищает клетки от окислительного стресса в культивируемых клетках дермального сосочка человека, Clinical, Cosmetic and Investigational Dermatology,  2021, 18 октября, 14:1519-1528; Влияние добавок токотриенола на рост волос у людей-добровольцев, Исследование тропических наук о жизни, 2010, декабрь, 21(2): 91–99; Декспантенол может быть новым средством лечения мужской андрогенетической алопеции: анализ девяти случаев, Dermatologic Therapy, 2020 May;33(3):e13381.

 

Вам также может понравиться:

 

6 лучших эфирных масел для остановки выпадения волос и восстановления роста волос

читать >>>

 

 

Потенциальные побочные эффекты финастерида

читать >>>

 

 

Средство от выпадения и истончения волос

читать >>>

 

 

О выпадении волос: 4 вещи, которые вам нужно знать

читать >>>

 

 

Как дигидротестостерон вызывает выпадение волос (андрогенетическую алопецию)?

читать >>>

 

 

Облысение — признак болезни сердца

читать >>>

 

 

Диабет увеличивает риск выпадения волос

читать >>>

 

 

Экстракт розмарина снижает уровень дигидротестостерона (ДГТ) в волосяных фолликулах

читать >>>

 

 

Масло розмарина так же эффективно, как Миноксидил, при андрогенетической алопеции

читать >>>

 

 

Мята перечная укрепляет и способствует росту волос

читать >>>

 

 

Кофеин помогает предотвратить облысение у мужчин и женщин

читать >>>

 

 

Сколько времени требуется для обновления вашей кожи?

читать >>>

 

 

Витамины для роста волос. Роль витамина B6 в поддержании здоровья волос , так как он действует как катализатор.Он активирует ферменты и химические реакции, которые запускают метаболизм белков волос, кератина и меланина, в волосяных фолликулах. Это заставляет волосяные фолликулы получать достаточное количество кератина и меланина, что способствует росту и обновлению волос.

Как витамины, которые регулируют половые гормоны, становятся витаминами для роста волос

Витамин B6 также контролирует выделение гормонов различными железами, такими как яичники и яички. Компонент витамина B6, известный как пиридоксаль-5-фосфат (PLP), регулирует функцию андрогенов или половых гормонов, т.е.е. тестостерон и эстроген. Эти гормоны оказывают прямое влияние на рост волос. Тестостерон приводит к выработке дигидротестостерона (ДГТ), который очень негативно влияет на рост волос и приводит к их выпадению, уменьшая продолжительность фазы роста волос (фаза анагена) и уменьшая размер волосяных фолликулов.

Употребление в пищу определенных витаминов или пищевых добавок может способствовать здоровому росту волос. Согласно исследованию, проведенному Институтом Полинга Университета штата Орегон Линус, витамин B6 связывается с рецепторами тестостерона и останавливает образование ДГТ.За счет этого восстанавливается естественный рост волос.

Витамины для роста волос в сочетании с другими элементами

Еще одно исследование, проведенное Британским журналом дерматологии в 2007 году, показало, что комбинация витамина В6 с цинком и азелаиновой кислотой в низких концентрациях может ингибировать 90% вредная активность тестостерона, т.е. образование ДГТ в волосяном фолликуле. Эти результаты были подтверждены журналом Корейского общества пластической и реконструктивной хирургии, в котором говорится, что использование комбинации азелаиновой кислоты и витамина В6 значительно ускоряет рост волос.Это исследование также показало, что витамин B6 помогает восстановить естественный цвет волос, увеличивая образование меланина — природного красящего пигмента — в организме.

В 2001 году польский журнал Wiadomosci Lekarskie также пришел к выводу, что инъекции витамина B6 предотвращают выпадение и истончение волос у женщин.

Нажмите здесь, чтобы получить полный список лучших витаминов против выпадения волос, которые вы можете начать принимать в качестве меры предосторожности уже сегодня.

Разнообразное питание, включающее витамин B-6, дает важные питательные вещества, необходимые для здоровых волос.

Уменьшение психических стрессов

Витамин B6 жизненно важен для развития нашего мозга, а также может помочь предотвратить депрессию, поскольку он играет важную роль в выработке гормонов серотонина и дофамина, которые влияют на наше настроение и нервную связь.

Витамин B6 также увеличивает приток насыщенной кислородом крови к волосяным фолликулам и коже головы. Эта кровь, насыщенная кислородом, значительно поддерживает рост и восстановление волос.

Пищевые источники витамина B6 и рекомендуемая суточная доза

Пищевые продукты, богатые витаминами для роста волос, включают индейку, курицу, рыбу, такую ​​как тунец и лосось.Другими источниками являются фисташки, семена подсолнечника, шпинат, авокадо и бананы. Рекомендуемая суточная доза витамина B6 составляет от 1,3 до 1,7 миллиграмма в день. Если вашего пищевого потребления витамина B6 недостаточно для удовлетворения суточной потребности, используйте пероральные добавки с витамином B6. Тем не менее, настоятельно рекомендуется не потреблять больше рекомендуемой дозы пероральных добавок витамина B6, так как более высокие количества могут иметь вредные побочные эффекты.

Влияет ли фолиевая кислота на рост волос?

Хотя питание играет роль в цикле роста ваших волос и общем состоянии здоровья, в настоящее время не так много авторитетных научных исследований о влиянии фолиевой кислоты на цикл роста ваших волос.

Ниже мы рассказали о том, что такое фолиевая кислота, а также о доступных научных исследованиях ее влияния на рост волос. Мы также говорили о других научно обоснованных методах лечения, которые вы можете использовать, если хотите стимулировать и ускорить цикл роста ваших волос.

Что такое фолиевая кислота?

Фолиевая кислота является витамином группы В. Он играет ключевую роль в создании новых клеток, в том числе клеток, из которых состоят ваши волосы, кожа, ногти и другие части вашего тела.

Возможно, вы слышали о витамине группы В, называемом фолиевой кислотой, или витамином В9.Фолиевая кислота представляет собой синтетическую форму фолиевой кислоты.

В то время как фолиевая кислота содержится в продуктах естественного происхождения, фолиевая кислота содержится в пищевых добавках и обогащенных пищевых продуктах.

Как женщине важно потреблять определенное количество фолиевой кислоты для поддержания оптимального репродуктивного здоровья, особенно если вы в настоящее время беременны или хотите забеременеть в ближайшем будущем.

По данным CDC, все женщины репродуктивного возраста должны принимать 400 мкг фолиевой кислоты в день.

Кроме того, CDC рекомендует употреблять в пищу продукты, содержащие фолиевую кислоту, в том числе обогащенный хлеб, рис, макароны и некоторые сухие завтраки.

Другие полезные для здоровья легкодоступные продукты, содержащие фолиевую кислоту, включают бобы, цитрусовые и зеленые листовые овощи.

Фолиевая кислота важна, поскольку снижает риск некоторых врожденных дефектов.

Исследования показывают, что высокое потребление фолиевой кислоты эффективно предотвращает дефекты нервной трубки, в том числе врожденные дефекты, которые могут повлиять на мозг и позвоночник ваших детей.

Добавки фолиевой кислоты широко доступны и недороги. Вы можете найти их в Интернете и в большинстве магазинов здоровой пищи.

How Your Hair Grows

Чтобы понять, как фолиевая кислота может повлиять на ваши волосы, в первую очередь важно знать основы того, как растут ваши волосы.

Каждый волосок на коже головы и на теле растет в рамках многоступенчатого цикла, который называется циклом роста волос. Этот цикл состоит из четырех фаз:

  • Фаза анагена (роста). Во время этой фазы ваши волосы вырастают из фолликула до полной длины.

  • Фаза катагена (регрессии). Во время этой фазы волосяной фолликул начинает сжиматься, и волосы отделяются от кожи головы.

  • Фаза телогена (отдыха). Во время этой фазы старые отслоившиеся волосы не растут, а на их месте начинает расти новый волос из фолликула.

  • Фаза экзогена (шеддинга). Во время этой фазы старые волосы выпадают, а их место занимают новые волосы.

Во время фазы анагена клетки, образующие каждый волос, быстро размножаются, позволяя волосу расти до полной длины.

Волосы на голове находятся в этой фазе от двух до шести лет, в то время как волосы на теле обычно завершают фазу анагена цикла роста всего за несколько месяцев.

В среднем от 80 до 90 процентов ваших волосяных фолликулов в любой момент времени находятся в фазе анагена, по сравнению с 10 процентами фолликулов в фазах катагена или телогена.

Большинство средств для роста волос стимулируют вступление волос в фазу анагена их цикла роста.

Например, миноксидил, средство для роста волос, уменьшает продолжительность фазы телогена (отдыха) в цикле роста волос и заставляет волосы раньше вступать в фазу анагена (роста), стимулируя рост и улучшая густоту ваших волос.

С другой стороны, большинство форм выпадения волос работают либо за счет повреждения волосяного фолликула, либо заставляя волосы переходить в телогенную или экзогенную фазы цикла роста.

Например, выпадение волос по женскому типу (женский эквивалент облысения по мужскому типу) вызывает выпадение волос из-за гормонального повреждения волосяных фолликулов, которое препятствует образованию новых волос.

Этот тип выпадения волос является необратимым, поэтому важно лечить его как можно раньше.

Аналогичным образом, рубцовая алопеция или рубцовое выпадение волос вызывает выпадение волос, разрушая волосяные фолликулы и замещая их фиброзной тканью.

Другие формы женского облысения, такие как телогеновая алопеция, вызывают выпадение волос, заставляя волосы преждевременно вступать в телогеновую (отдыхающую) фазу цикла роста, прежде чем они смогут отрасти до полной длины.

Чтобы добавки для роста волос, лекарства или другие средства были эффективными, они должны либо стимулировать рост ваших волос, либо защищать их от гормонов, образования рубцов или других повреждений, которые могут вызвать выпадение волос.

финастерид для женщин
единственный в своем роде спрей от выпадения волос

Влияет ли фолиевая кислота на рост волос?

Несмотря на большое количество научных исследований о пользе фолиевой кислоты во время беременности, относительно мало данных о ее эффективности в качестве средства для лечения роста волос.Доступно лишь небольшое количество исследований, результаты которых неоднозначны и далеки от окончательных.

Одно небольшое исследование, опубликованное в 2017 году, изучало возможную связь между фолиевой кислотой, витамином B12 и биотином у людей с преждевременным поседением волос.

Используя данные 52 добровольцев, исследователи обнаружили, что преждевременная седина связана с более низким уровнем фолиевой кислоты, витамина B12 и биотина в сыворотке крови.

Однако исследование не установило никакой связи между уровнем фолиевой кислоты и выпадением или ростом волос.

Другое исследование, опубликованное в Journal of Drugs in Dermatology, проанализировало связь между низким уровнем фолиевой кислоты и телогеновой алопецией, формой выпадения волос без образования рубцов, при которой волосы быстро вступают в телогеновую (отдыхающую) фазу цикла роста.

Хотя исследователи обнаружили связь между дефицитом ферритина, витамина D и цинка и выпадением волос, они не обнаружили никакой связи между низким уровнем фолиевой кислоты и телогеновой алопецией.

В другом небольшом исследовании 2013 года также изучалась возможная связь между уровнями витамина B12 и фолиевой кислоты и выпадением волос.

В этом исследовании принимали участие пациенты, страдающие очаговой алопецией — формой аутоиммунного выпадения волос, при которой волосы часто выпадают пятнисто.

Это исследование не выявило существенных различий в уровнях витамина B12 или фолиевой кислоты между группой пациентов с очаговой алопецией и контрольной группой.

Напротив, в исследовании 2014 года, опубликованном в Индийском журнале дерматологии, изучались различия в концентрации фолиевой кислоты в эритроцитах у людей с очаговой алопецией и у людей без заметного выпадения волос.

Это исследование показало, что в группе людей с очаговой алопецией средний уровень фолиевой кислоты в эритроцитах был значительно ниже, чем в контрольной группе.

Интересно, что исследователи также заметили, что у людей с наиболее сильным выпадением волос был самый низкий уровень фолиевой кислоты в эритроцитах.

В целом исследования влияния фолиевой кислоты на рост волос неоднозначны. Большинство исследований практически не показывают связи между уровнями фолиевой кислоты (или фолиевой кислоты) и выпадением волос, особенно по сравнению с другими гормонами и питательными веществами, которые тесно связаны со здоровьем волос.

Тем не менее, есть также небольшое количество научных исследований, предполагающих, что фолиевая кислота может оказывать некоторое влияние на рост.

Как использовать фолиевую кислоту

Хотя наука о фолиевой кислоте и волосах неоднозначна, добавки фолиевой кислоты по-прежнему обладают многочисленными преимуществами для здоровья, особенно если вы беременны или планируете забеременеть в будущем.

Самый простой способ использовать фолиевую кислоту — это принимать добавки с фолиевой кислотой. Вы можете приобрести фолиевую кислоту в большинстве магазинов здоровой пищи, аптеках и интернет-магазинах пищевых добавок.

CDC рекомендует всем женщинам репродуктивного возраста ежедневно принимать 400 микрограммов (мкг) фолиевой кислоты в дополнение к пище, содержащей фолиевую кислоту.

Если вы беременны или кормите грудью, рекомендуемая доза фолиевой кислоты в рационе немного выше, чем для небеременных женщин. Управление пищевых добавок рекомендует следующие уровни фолиевой кислоты для беременных и кормящих женщин:

  • Во время беременности 600 мкг фолиевой кислоты или пищевых эквивалентов фолиевой кислоты (DFE)

  • DFEs)

Многие распространенные продукты богаты фолиевой кислотой, естественной формой фолиевой кислоты.

Хорошими источниками пищевых фолатов являются темно-зеленые, листовые овощи и другие овощи, фрукты и фруктовые соки, бобы, орехи, молочные продукты, яйца, горох, красное мясо и птица.

Шпинат, брюссельская капуста, спаржа, черный горох и говяжья печень содержат очень значительное количество фолиевой кислоты, что делает их хорошим дополнением к вашему рациону, если вы обеспокоены низким уровнем фолиевой кислоты.

Например, полстакана вареного шпината содержит примерно одну треть дневной нормы фолиевой кислоты.

Многие распространенные продукты обогащены фолиевой кислотой и другими питательными веществами.

Старайтесь покупать хлопья для завтрака, хлеб, макароны, пасту и другие продукты, содержащие фолиевую кислоту, чтобы убедиться, что вы получаете рекомендуемое потребление.

Другие способы отрастить волосы и предотвратить их выпадение

Хотя научные данные о фолиевой кислоте и росте волос противоречивы, существуют реальные, научно обоснованные средства, которые можно использовать для улучшения роста волос и предотвращения их выпадения.

Одним из наиболее эффективных средств для предотвращения выпадения волос и улучшения их роста является миноксидил, местное лекарство, которое продается в виде жидкости или пены.

Миноксидил укорачивает фазу телогена цикла роста волос и переводит спящие волосы в фазу анагена. Он также увеличивает продолжительность фазы анагена, позволяя вашим волосам расти дольше перед выпадением.

Есть также некоторые научные доказательства того, что миноксидил может увеличить длину и диаметр ваших волос.

Мы предлагаем миноксидил онлайн, отдельно или вместе с шампунем и биотином в нашем комплексном наборе для волос.

Обычно требуется около четырех месяцев, чтобы увидеть заметные результаты от миноксидила.Вы можете узнать больше о том, как работает миноксидил, о его преимуществах и о том, как использовать его для роста волос, в нашем полном руководстве по миноксидилу от выпадения волос у женщин.

Помимо миноксидила, здоровое питание играет ключевую роль в поддержании силы, густоты и здоровья ваших волос. В нашем руководстве по лучшим продуктам для здоровых волос перечислены конкретные продукты и питательные вещества, которые могут помочь вам снизить риск выпадения волос из-за дефицита питательных веществ.

спиронолактон против выпадения волос
волос, знакомьтесь с наукой.вы двое поладите

В заключение

Фолиевая кислота обладает рядом преимуществ для здоровья, особенно если вы беременны или планируете забеременеть в ближайшем будущем.

Тем не менее, научные данные о его потенциальной пользе для волос не очень точны. Сейчас доступно только несколько небольших исследований.

Они привели к неоднозначным выводам, большинство из которых обнаружили, что между уровнями фолиевой кислоты и ростом волос практически нет связи.

Для общего состояния здоровья старайтесь придерживаться рекомендации Центра по контролю и профилактике заболеваний (CDC) в 400 мкг фолиевой кислоты в день или немного больше, если вы беременны или кормите грудью.

Если вы заметили, что у вас истончаются волосы, обратитесь к своему лечащему врачу. Они смогут порекомендовать безопасное, научно обоснованное лечение, которое поможет вам справиться с выпадением волос и способствовать их здоровому росту.

Выпадение волос по женскому типу — Лучшие добавки

Существует множество причин выпадения волос у женщин. Генетически связанное выпадение волос (андрогенетическое выпадение волос, также известное как выпадение волос по женскому типу) обычно появляется у женщин в возрасте от 40 до 50 лет. Тем не менее, в некоторых случаях истончение волос по женскому типу может происходить у женщин уже в возрасте от 20 до 30 лет.

Что такое выпадение волос по женскому типу?

При выпадении волос по женскому типу (FPHL) женщина начинает замечать истончение волос вокруг линии пробора скальпа и по краям линии роста волос. Как правило, FPHL проявляется у женщин в возрасте от 40 до 60 лет, но может поражать женщин в любом возрасте. В дополнение к генетическим и гормональным изменениям, затрагивающим женщин в этой возрастной группе, довольно много внешних факторов могут вызвать чрезмерное выпадение волос и их быстрое выпадение. К ним относятся эмоциональный стресс, неадекватное питание и сопутствующие заболевания.

Какова роль дигидротестостерона (ДГТ) в выпадении волос у женщин?

Основной причиной генетического выпадения волос является воздействие гормона ДГТ (дигидротестостерон) на наши волосяные фолликулы. Повышенный уровень ДГТ заставляет волосяной фолликул сжиматься и образовывать крошечные невидимые волоски. ДГТ является более мощной версией мужского гормона тестостерона, который встречается у мужчин и женщин. Фермент в наших клетках, 5а-редуктаза, превращает тестостерон в ДГТ. Избыток ДГТ и тестостерона может вызвать андрогенетическую потерю волос у мужчин и женщин, увеличение количества прыщей, увеличение выработки кожного сала (себорея) и гирсутизм (оволосение на лице у женщин).Уменьшение превращения тестостерона в ДГТ поможет уменьшить выпадение волос, связанное с андрогенами, и уменьшить появление прыщей, себорейного дерматита и гирсутизма.

Какие натуральные ингредиенты наиболее эффективны для женщин с генетической или возрастной потерей волос?

Экстракт ягод пальмы сереноа

Saw Palmetto поддерживает здоровый рост волос, предотвращая превращение тестостерона в ДГТ и уменьшая воздействие ДГТ на волосяные фолликулы. По-видимому, наиболее важными ингибиторами 5-альфа-редуктазы являются лауриновая, миристиновая и олеиновая кислоты.

Масло семян тыквы

Масло семян тыквы содержит фитостерол, который предотвращает превращение тестостерона в ДГТ и, таким образом, улучшает рост волос. Исследование, сравнивающее влияние перорального употребления тыквы на выпадение волос, показало увеличение количества волос на 40% по сравнению с 10% в контрольной группе.

Капсаицин

В одном исследовании у 88% людей, принимавших перорально капсаицин, наблюдалось возобновление роста волос. В другом исследовании применение сыворотки для местного применения, похожей по структуре на капсаицин, стимулировало отрастание волос у 50% пользователей.

Кофеин

Кофеин стимулирует клеточную пролиферацию, противодействует тормозящему действию тестостерона на рост волос и продлевает продолжительность фазы роста волос (анаген).

Пептиды и аминокислоты

Было установлено, что пероральный прием L-цистеина в сочетании с ретинолом лечит диффузную алопецию и приводит к увеличению густоты волос и скорости анагена. Пероральный прием L-цистеина в сочетании с гистидином, медью и цинком улучшил среднее изменение общего количества волос через 50 недель у 24 человек с андрогенетической потерей волос.

Зеленый чай

Галлат эпигаллокатехина (ЭГКГ) стимулирует рост волос человека благодаря своему пролиферативному действию на волосяной фолликул. Также было обнаружено, что он блокирует активность 5α-редуктазы, которая превращает тестостерон в ДГТ.

Масло листьев розмарина

Масло листьев розмарина — это натуральный растительный экстракт, который стимулирует рост волос, делает кожу головы здоровой и делает волосы более густыми. Это помогает улучшить кровообращение и сосудистую систему кожи головы, что способствует регенерации фолликулов, аналогичный эффект проявляет миноксидил.

Экстракт коры пиджеума

Богатая фитостеролами кора пиджеума блокирует действие ДГТ на волосяные фолликулы, усиливая рост волос у женщин и мужчин с генетической андрогенетической потерей волос.

Порошок цельного растения брокколи

Брокколи богата антиоксидантами, которые уменьшают повреждение кожи головы свободными радикалами. Витамины группы В в экстракте брокколи могут помочь уменьшить стресс, фактор, который может способствовать выпадению волос.

Томатный порошок

Порошок плодов томата содержит ликопин, который играет важную роль в улучшении кровотока и помогает восстановлению клеток кожи головы, улучшая здоровье волос.

Грибы майтаке и рейши

Известные как мощные адаптогены, иммуномодуляторы и ингибиторы 5α-редуктазы, эти экстракты грибов поддерживают здоровье кожи головы и стимулируют рост новых волос.

Крапива двудомная

Также известное как растение Urtica dioica, оно веками использовалось индейскими и европейскими культурами для лечения выпадения волос. Листья крапивы также содержат кверцетин, который является мощным противовоспалительным средством. Этот эффект может принести пользу большинству типов волос, улучшая здоровье кожи головы и помогая естественному отрастанию волос.

Алоэ вера

Алоэ вера — вечнозеленый кактус, произрастающий во многих тропических и субтропических регионах. Было обнаружено, что один из его ингредиентов, алоенин, стимулирует рост волос.

Какие витамины лучше всего подходят от выпадения волос у женщин?

Существуют различные витамины и минералы, которые вы должны включить в свой рацион, чтобы поддерживать здоровье кожи головы и волосяных фолликулов, предотвращать дальнейшее выпадение волос и способствовать их восстановлению. Если вы имеете дело с выпадением волос по женскому типу, вот некоторые из основных питательных веществ, которые вы должны искать при приеме добавок против выпадения волос:

Витамин А

Наличие необходимого количества витамина А в коже головы необходимо для здорового роста волос.Дефицит витамина А приводит к сильной сухости кожи и может вызвать внезапное выпадение волос (телогеновая алопеция) и ломкость волос.

Семейство витаминов группы В

Комплекс витаминов группы В содержит 8 различных витаминов. Дефицит рибофлавина (B2), биотина (B7), фолиевой кислоты и витамина B12 связан с выпадением волос. Одно исследование показало, что достаточный дефицит биотина приводит к неоднородной алопеции и ломкости ногтей, а выпадение волос устраняется пероральным приемом биотина.Фолат и витамин B12 играют важную роль в метаболизме волосяных фолликулов.

Витамины B9 (фолиевая кислота) и B12

Фолиевая кислота и B12 способствуют циркуляции эритроцитов, поддерживая здоровье волосяных фолликулов и делая волосы здоровыми. Дефицит этих двух витаминов связан с выпадением волос. Фолиевая кислота (или фолиевая кислота) также способствует кератинизации волос, то есть помогает волосяным фолликулам вырабатывать кератин для сильных волос. Важное замечание для тех, кто придерживается веганской диеты: важно убедиться, что вы получаете достаточное количество витамина B12 из пищевых добавок, поскольку он в основном содержится в животных источниках (включая яйца, молочные продукты, мясо и рыбу).

Витамин В5 (пантотеновая кислота) и витамин В6 (пиридоксин)

Витамин B5 и витамин B6 известны тем, что помогают уменьшить стресс — распространенный триггер выпадения волос. Эти витамины также помогают укреплять и питать волосяные фолликулы для оптимального роста и здоровья волос. Витамин B6 может также ингибировать выработку дигидротестостерона (ДГТ), который является андрогеном. ДГТ может связываться с рецепторами волосяных фолликулов, заставляя их сокращаться и производить более тонкие волосы, прежде чем в конечном итоге перестанут расти новые волосы.

Витамин С

Витамин С необходим для правильного всасывания железа в нашем кишечнике. Таким образом, пероральные добавки витамина С играют важную роль, когда выпадение волос связано с дефицитом железа. Также было показано, что витамин С вызывает удлинение стержня волоса в культивируемых волосяных фолликулах человека. Витамин С также является антиоксидантом, который способствует выработке коллагена, который дает организму незаменимые аминокислоты, необходимые для образования кератина (белка волос). Это также помогает организму более эффективно усваивать железо.

Витамин D

Витамин D имеет решающее значение для здоровья волос, так как низкий уровень этого витамина связан с несколькими формами выпадения волос, включая андрогенетическую алопецию. Ранние исследования также показали, что витамин D может стимулировать рост волос.

Витамин Е

Витамин Е необходим для здоровья кожи головы, так как его мощные антиоксидантные свойства помогают уменьшить повреждение свободных радикалов кожи головы и волосяных фолликулов. Окислительный стресс был связан с выпадением волос. Витамин Е помогает уменьшить окислительный стресс в коже головы.Исследование с участием 21 добровольца, получавших витамин Е, показало значительное увеличение количества волос по сравнению с группой плацебо.

Витамин К2

Витамин К2 стимулирует приток крови к коже головы, доставляя столь необходимый кислород и питательные вещества в область, способствующую здоровому росту волос. Это также антиоксидант, который помогает защитить волосяные фолликулы от повреждения свободными радикалами.

Какие минералы лучше всего подходят для лечения выпадения волос у женщин?

Цинк

Наиболее важным минералом для роста и силы волос является цинк.Исследование клеток кожи человека показало, что цинк является мощным ингибитором активности 5-альфа-редуктазы. Уменьшение действия 5-альфа-редуктазы может блокировать воздействие ДГТ на волосяной фолликул и помочь при андрогенетической потере волос по женскому типу. Прием витамина В6 с цинком усиливал ингибирующее действие цинка на 5-альфа-редуктазу.

Кальций

Кальций играет жизненно важную роль в здоровье ваших волос. Этот минерал помогает уменьшить ломкость волос, а также предотвращает пересушивание кожи головы.В качестве бонуса он отлично подходит для здоровья ногтей, помогая предотвратить их ломкость.

Железо

Дефицит железа является частой причиной телогеновой алопеции и может способствовать выпадению волос по женскому типу.

Селен

Селен играет решающую роль в предотвращении окислительного повреждения морфогенеза волосяного фолликула. Селен также играет жизненно важную роль в синтезе белка в организме и помогает повысить эластичность волос, предотвращая их ломкость. Исследование людей, принимавших селен, показало увеличение роста волос.

Йод, магний, марганец и хром

Эти минералы играют важную роль в поддержании здоровья кожи головы и стимулировании роста здоровых и густых новых волос. Йод помогает поддерживать правильное функционирование волосяных фолликулов, а дефицит этого минерала связан с выпадением волос. Магний необходим для здоровья кожи головы. Он предотвращает накопление кальция, который может закупоривать волосяные фолликулы и препятствовать здоровью волос, улучшая циркуляцию кальция. Марганец, обладающий антиоксидантными свойствами, способствует усвоению кальция, а хром способствует метаболизму белков.

Какая добавка лучше всего подходит для лечения генетического и возрастного выпадения волос?

Лучшие добавки для женщин с генетическим и возрастным выпадением волос содержат ингредиенты, блокирующие ДГТ. Эти ингредиенты блокируют действие мужского гормона на волосяные фолликулы и способствуют нормальному отрастанию новых, более здоровых и сильных волос. Для достижения наилучших результатов эти блокаторы ДГТ следует сочетать с витаминами, минералами и пептидами, необходимыми для правильного функционирования волосяных фолликулов, и адаптогенами для улучшения здоровья кожи головы.

Какие добавки лучше всего подходят для лечения выпадения волос, связанного с щитовидной железой?

Дисфункция щитовидной железы является частой причиной повышенного выпадения и истончения волос. Если у вас аномальные уровни гормонов щитовидной железы или заболевания, связанные с щитовидной железой, вам необходимо проконсультироваться с местным врачом для правильной диагностики и лечения. Витамины и минералы, специфичные для щитовидной железы, можно использовать для поддержки функции щитовидной железы, когда уровень гормонов щитовидной железы (Т3, Т4) в крови находится в нормальном диапазоне.

Йод

Дефицит йода вызывает заболевания щитовидной железы. Он необходим для производства трийодтиронина (Т3) и тироксина (Т4).

Селен

Наша щитовидная железа содержит большое количество селена, и его дефицит может привести к дисфункции щитовидной железы. Помимо своей роли в производстве гормонов щитовидной железы, селен помогает защитить щитовидную железу от повреждений, вызванных окислительным стрессом.

Железо

Дефицит железа связан с дисфункцией щитовидной железы.Щитовидная железа зависит от железа для преобразования Т4 в Т3, активную форму гормона щитовидной железы.

Цинк

Надлежащее количество цинка необходимо для здорового уровня Т3, Т4 и тиреотропного гормона (ТТГ).

Витамины

Витамины B и E также необходимы для функции щитовидной железы. Дефицит этих витаминов может негативно сказаться на здоровье щитовидной железы и увеличить риск заболевания щитовидной железы.

Отличным примером добавок, которые могут помочь волосам и поддержать вашу щитовидную железу, являются добавки для восстановления MDacne.Эти добавки содержат оптимальное количество йода, железа, цинка, селена и витаминов В и Е.

Какие добавки следует избегать при выпадении волос?

Старайтесь избегать универсальных пищевых добавок для кожи, волос и ногтей, а также поливитаминов. Те недорогие витаминные добавки, которые часто продаются в Walmart или Amazon, обычно содержат небольшое количество активных ингредиентов и могут быть не такими эффективными, как специальные добавки для ухода за волосами. Еще один вид «добавок для волос», которых следует избегать, — это жевательные резинки: эти жевательные конфеты, как правило, содержат много сахара и минимум активных ингредиентов.

Высококачественные добавки для ухода за волосами, специально разработанные для восстановления роста волос, такие как индивидуальная добавка для ухода за волосами MDhair, Nutrafol или Viviscal, могут включать до 20 ингредиентов. Для сравнения, недорогие жевательные резинки для волос обычно содержат 2–3 ингредиента (и целый грузовик сахара).

Биотиновые добавки для женщин с выпадением волос — стоит ли их использовать?

Биотин является отличным ингредиентом добавок для роста волос. Тем не менее, это всего лишь один второстепенный элемент для оптимального лечения.Лучшим выбором будет добавка для роста волос, разработанная дерматологами, которая нацелена на все возможные факторы и недостатки, которые могут вызвать выпадение волос.

Как коллагеновые добавки влияют на выпадение волос?

Прием коллагеновых пептидов является отличным дополнением к лечению выпадения волос у женщин. Проверьте эту ссылку для получения информации.

Как использовать пищевые добавки для ухода за волосами

Важным фактором успеха любого лечения выпадения волос является приверженность лечению.Ищите добавки, которые содержат все необходимые витамины и минералы в одной капсуле, которую можно принимать один раз в день. Использование добавок, требующих две или более капсул в день, менее удобно и приведет к прекращению лечения.


Каталожные номера:

аналогов витамина D3 стимулируют рост волос у голых мышей | Эндокринология

Аннотация

Активная форма витамина D 3 может регулировать ороговение эпидермиса, индуцируя терминальную дифференцировку; а у мышей, лишенных рецептора витамина D, обнаруживаются дефекты, приводящие к постнатальной алопеции.Эти наблюдения указывают на участие витамина D 3 в регуляции роста волос. Мы проверили способность 1,25-дигидроксивитамина D 3 и его синтетических аналогов стимулировать рост волос у мышей biege/nude/xid (BNX) nu/nu (nude) с врожденной алопецией. Бестимусных мышей лечили различными аналогами витамина D 3 в дозах, которые, как мы ранее установили, были самыми высокими дозами, не вызывающими токсичности (гиперкальциемия). У мышей наблюдали за ростом волос и оценивали в соответствии с определенной шкалой.Образцы кожи были взяты для гистологического исследования волосяных фолликулов и для выделения РНК и белка. Аналоги витамина D 3 резко стимулировали рост шерсти голых мышей, хотя исходный 1,25-дигидроксивитамин D 3 не оказывал никакого действия. Рост волос происходил циклически, сопровождаясь образованием нормальных волосяных фолликулов и повышенной экспрессией некоторых кератинов (На7, На8 и Нb3). Аналоги витамина D 3 , по-видимому, действуют на кератиноциты, инициируя цикличность волосяных фолликулов и стимулируя рост волос у мышей, у которых иначе волосы не растут.

ВО ВРЕМЯ наших исследований противоопухолевых свойств аналогов витамина D 3 мы регулярно использовали мышей с тройным иммунодефицитом бежевых/телесных/xid (BNX) nu/nu (голых) для проверки способности этих соединений предотвращать рост опухоли in vivo . Мы заметили, что у голых мышей вырастали волосы, когда они получали определенные аналоги витамина D 3 .

Голые мыши имеют изменение зародышевой линии гена Whn (недавно названного Foxn1), влияющее как на рост фолликулярных волос, так и на развитие тимуса (1, 2).У этих мышей ген Whn имеет делецию одного нуклеотида, вызывающую мутацию сдвига рамки считывания с преждевременной терминацией, приводящей к нефункциональному белку. Ген Whn, фактор транскрипции forkhead, экспрессируется исключительно в эпителиальных клетках у всех видов позвоночных. Гены Whn человека и мыши имеют 85% идентичность последовательностей (2). Люди с голым фенотипом также имеют врожденную алопецию в результате бессмысленной мутации этого гена (3). Транскрипционные мишени Whn должны быть определены, но они включают гены кератина в волосяном фолликуле.Whn необходим для созревания и дифференцировки клеток матриксного эпителия. В норме он экспрессируется в фолликулярной луковице и наружном корневом влагалище волосяного стержня при формировании волос; недостаток этого генного продукта у голых мышей приводит к неправильной кератинизации фолликулярных эпителиальных клеток, что приводит к дефектам корневого влагалища, кутикулы и коры, что приводит к ослаблению волос (2, 4, 5). Волосы распадаются в фолликулах, образуя дермальные кисты (4), которые содержат ороговевший материал.

Активная форма витамина D 3 является лигандом ядерного рецептора гормонов, рецептора витамина D 3 (VDR).Мыши с нокаутом VDR не могут инициировать новый цикл волосяного покрова, проявляя постнатальную алопецию (6). Экспрессия VDR в дермальном сосочке фолликулярных кератиноцитов во время анагенной (рост) и катагенной (прекращение) стадий цикла роста волос указывает на роль VDR в развитии цикла роста волос (7). Более того, обработка кератиноцитов тремя аналогами витамина D 3 ингибировала пролиферацию и стимулировала дифференцировку (8).

Эти наблюдения побудили нас изучить способность аналогов витамина D 3 стимулировать рост волос у бестимусных мышей с дефектами кератиноцитов.Было разработано большое количество аналогов витамина D 3 , которые обладают большей способностью индуцировать дифференцировку и ингибировать пролиферацию, но вызывают меньшую гиперкальциемию, чем физиологически активное соединение, 1,25-дигидроксивитамин D 3 [1,25(OH ) 2 Д 3 ] (9). Мы выбрали шесть аналогов витамина D 3 , которые соответствовали этим характеристикам, и исследовали их способность вызывать рост волос у бестимусных мышей (10–15).

Материалы и методы

Мыши

В наших исследованиях использовали

самцов и самок мышей BNX nu/nu в возрасте 8 недель.Животные содержались в виварии Медицинского центра Cedars-Sinai, и эксперименты проводились в соответствии с установленными правилами. В одной серии экспериментов по три самца были распределены в каждую из шести групп, и каждая когорта получала разные соединения витамина D 3 , а седьмая группа состояла из необработанного контроля BNX nu/nu . Кроме того, три самца и три самки мышей получали аналог витамина D 3 , EB1089. Все аналоги вводили внутрибрюшинно три раза в неделю в объеме 200 мкл PBS.Для экспериментов по выщипыванию волос волосы выдергивали из нижней части спины мышей C57 BL/6 и вводили аналоги витамина D 3 , как описано выше.

Витамин D

3 соединения

Соединения витамина D 3 (рис. 1) растворяли в абсолютном этаноле перед определением молярной концентрации, измеренной по УФ-поглощению с использованием их молярного коэффициента экстинкции при 264 нм. Все аналоги хранили в темноте и при -80°С в абсолютном этаноле в виде исходных растворов 10 -3 м.д.Последнее разведение делали в PBS перед введением мышам. Мышам давали дозы соединений витамина D 3 , которые, как мы ранее обнаружили, не вызывали токсичности, включая гиперкальциемию. Кроме того, мы контролировали уровень кальция в сыворотке во время лечения.

Рисунок 1.

Физическая структура витамина D 3 соединения, используемые в этом исследовании.

Рисунок 1.

Физическая структура витамина D 3 соединения, используемые в этом исследовании.

1,25-(ОН)
2 Д 3

1α,25-дигидроксихолекальциферол, физиологически активная форма витамина D 3 , вводили в дозе 0,0625 мкг/мышь; это было сделано Hoffman-LaRoche Inc.

Ro 25-9022

1α,25-(OH) 2 -16-ен-23-ин-26,27-F6–19-нор-витамин D 3 имеет шесть атомов фтора в боковой цепи, ненасыщенность при С16 и С23, и удаление метиленовой группы C-19. Его вводили в 0.00125 мкг/мышь. Этот аналог изготовлен компанией Hoffman-LaRoche Inc.

KH 1060
.

1α,25-(OH) 2 -20-эпи-22-окса-24,26,27-тришомо-витамин D 3 имеет удлинение боковой цепи и замену углерода C 22 на кислород. Он был произведен Leo Pharmaceuticals и вводился в дозе 0,0125 мкг/мышь.

EB1089

1α,25-(OH) 2 -диен-24,26,27-тригомо-витамин D 3 имеет измененную боковую цепь, содержащую 26,27 диметильных групп, со вставкой дополнительного углерода в положении C- 24 (24а) и две двойные связи транс при атомах углерода 22, 23 и 24, 24а.Он был произведен Leo Pharmaceuticals и давался в дозе 0,05 мкг/мышь.

Ро 27-0574

1α,25(OH) 2 -23-ен-26,27-гексафтор-19-нор-20-циклопил витамин D 3 содержит шесть атомов фтора в боковой цепи, транс-23,24 двойной связь и циклопропильную группу при C 20 . Он был произведен Hoffman-LaRoche Inc. и давался в дозе 0,005 мкг/мышь.

Ро 27-5646

1α,25(OH) 2 -(3-метил-3-гидроксибутил)-19-нор-витамин D 3 имеет две боковые цепи с удаленной метиленовой группой C-19 и имеет в 0.01 мкг/мышь. Изготовлено компанией Hoffman-LaRoche Inc.

Ro 26-9114

1α,25(OH) 2 -16-ен-19-нор-24-оксо-витамин D 3 содержит двойную связь в положении С-16 и кетогруппу в боковой цепи. Он был синтезирован компанией Hoffman-LaRoche Inc. и вводился в дозе 6 мкг/мышь.

Шкала для мониторинга шерсти у мышей BNX nu/nu

Мы разработали шкалу для измерения роста волос у мышей BNX (таблица 1).

Таблица 1.

Шкала для мониторинга волос у мышей BNX nu / nu

SCORE . ОПИСАНИЕ .
1 розовый кожи, без волос
2 Кожа толстая, пигментированы, без волос
3 Кожа толстая, сильно пигментированы, без волос
4 Толстая кожа, пигментированные, рассеянные волосы
5 Волосы 1–10% тела
6 волосы 10–25% из тела
волосы 10–25% от тела
0910979.

0979.7
. .0979.79.

. .

097191
. ..0971 .
8 волосы 50–75% тела
волосы> 75% из тела
10
10
10 70967
. . ОПИСАНИЕ .
1 розовый кожи, без волос
2 Кожа толстая, пигментированы, без волос
3 Кожа толстая, сильно пигментированы, без волос
4 Толстая кожа, пигментированные, рассеянные волосы
5 Волосы 1–10% тела
6 волосы 10–25% из тела
волосы 10–25% от тела
0910979.

0979.7
. .0979.79.

. .

097191
. ..0971 .
8 Волосы 50–75% тела
волосы> 75% из тела
10 70967
10 70967
10 70967
.

Шкала для мониторинга волос у мышей BNX nu / nu

SCORE . ОПИСАНИЕ .
1 розовый кожи, без волос
2 Кожа толстая, пигментированы, без волос
3 Кожа толстая, сильно пигментированы, без волос
4 Толстая кожа, пигментированные, рассеянные волосы
5 Волосы 1–10% тела
6 волосы 10–25% из тела
волосы 10–25% от тела
0910979.

0979.7
. .0979.79.

. .

097191
. ..0971 .
8 волосы 50–75% тела
волосы> 75% из тела
10
10
10 70967
. . ОПИСАНИЕ .
1 розовый кожи, без волос
2 Кожа толстая, пигментированы, без волос
3 Кожа толстая, сильно пигментированы, без волос
4 Кожа толстая, пигментированные, разбросанные волосы
5 волос 1-10% тела
6 волос 10-25% тела
7 волос 25-50% тела
8 Волосы 50–75% тела
волосы> 75% из тела
10
10
10
10 1967
10 7110967
10 711.
10 7.
.

Образцы кожи были получены после обработки либо соединениями витамина D 3 , либо контрольным разбавителем.Их фиксировали для гистологического анализа в 10% нейтральном забуференном формалине, окрашивали гематоксилином/эозином и исследовали под микроскопом.

Анализ РНК

Образцы кожи мышей с их пиковым баллом были обработаны для определения РНК, преобразованы в кДНК и использованы в ПЦР для изучения экспрессии генов различных кератинов (10). Праймеры для генов кератина показаны в таблице 2.

Таблица 2.

Праймеры для генов кератина

Тип кератина волос . Передняя грунтовка . Обратный грунт .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
1 мкг / мышь Ro 27-0574 Ro 26-9114 КН 1060 Ro 27-5646 Ro 27-0574 1089 ЕВ Ro 26-9114 Ro 25-9022 КН 1060
Тип волос . Передняя грунтовка . Обратный грунт .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC Таблица 2.

Праймеры для генов кератина

Тип кератина волос . Передняя грунтовка . Обратный грунт .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Тип волос . Передняя грунтовка . Обратный грунт .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG

Анализ белка

Для вестерн-блоттинга использовали антисыворотку

против белков кератина, чтобы установить паттерны экспрессии на уровне белков (16, 17).Одна антисыворотка была против кислого кератина волос I типа На8, который обычно демонстрирует сложный характер экспрессии в растущих фолликулах; и второй признанный основной кератин волос типа II Hb3.

Результаты

Голые мыши получали либо соединения витамина D 3 , либо контрольный разбавитель в дозе, которая, как мы ранее обнаружили, ингибирует клональную пролиферацию раковых клеток, но не связана с гиперкальциемией, которая является основной токсичностью витамина D 3 (таблица 3). , Рис.1 и ссылки. 10–13). У этих мышей развились волосы, как показано на рис. 2. Гистологическое исследование подтвердило, что аналоги витамина D 3 стимулировали образование волосяных фолликулов (рис. 3). Микроскопическое исследование образцов кожи с пиковым баллом 8 в группах лечения аналогами витамина D 3 показало полностью сформированный волосяной фолликул; напротив, в контрольных образцах не наблюдалось ни одного волосяного фолликула или были только искаженные волосяные фолликулы.

Рисунок 2.

Фотография голых мышей.А. Верхние мыши получали контрольный разбавитель, а мыши нижние получали аналог витамина D 3 , Ro 25-9022, по 0,00125 мкг/мышь внутрибрюшинно три раза в неделю. B, мыши получили, слева направо : Ro 27-5646 в дозе 0,01 мкг/мышь, контроль с разбавителем и Ro27-0574 в дозе 0,005 мкг/мышь.

Рисунок 2.

Фотография голых мышей. А. Мышь , верхняя часть , получала контрольный разбавитель, а мышь , нижняя часть , получала аналог витамина D 3 , Ro 25-9022, при 0.00125 мкг/мышь внутрибрюшинно три раза в неделю. B, мыши получили, слева направо : Ro 27-5646 в дозе 0,01 мкг/мышь, контроль с разбавителем и Ro27-0574 в дозе 0,005 мкг/мышь.

Рисунок 3.

A, Кожа контрольной голой мыши с абортивными волосяными фолликулами и рудиментарными сально-волосяными единицами. Тестовая голая мышь (B) показывает нормальные волосяные фолликулы, проникающие в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг/мышь внутрибрюшинно три раза в неделю в течение 36 дней (см.2). Срезы окрашивали гематоксилином и эозином (исходное увеличение, ×100).

Рисунок 3.

A, Кожа контрольной голой мыши с абортивными волосяными фолликулами и рудиментарными сально-волосяными единицами. Тестовая голая мышь (B) показывает нормальные волосяные фолликулы, проникающие в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг/мышь внутрибрюшинно три раза в неделю в течение 36 дней (см. фиг. 2). Срезы окрашивали гематоксилином и эозином (исходное увеличение, ×100).

Таблица 3.

Витамин D 3 соединения: обзор их антипролиферативной и кальциемической активности

1 мкг / мышь Ro 27-0574 Ro 26-9114 КН 1060 Ro 27-5646 Ro 27-0574 1089 ЕВ Ro 26-9114 Ro 25-9022 КН 1060
соединения . ЭД 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МКФ-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,
10
2 × 10 -10 2 × 10 -9 ND 14
ЕВ 1089 5 × 10 -11 0,5 мкг / кг 12
1 × 10 -10 6 мкг / мышь 11
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
1 × 10 -12 1 × 10 -10 0,0125 мкг / мышь 13
1,25 (ОН) 2 D 3 1 × 10 -8 1 × 10 -7 0,0625 мкг/Mouse 9097 0,0625 мкг.
Соединения . ЭД 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МКФ-7 .
2 × 10 -10 4 × 10 -10 0,01 мкг / мышь 10
2 × 10 -10 2 × 10 -9 Н.Д. 14
5 × 10 -11 0.5 мкг / кг 12
1 × 10 -10 6 мкг / мышь 11
2 × 10 — 10 6 × 10 -10 0,00125 мкг / мышь 15
1 × 10 -12 1 × 10 -10 0,0125 мкг / мышь 13
1,25 (OH) 2 D 3 1 × 10 -8 1 × -8 1 × -8 1 × -8 1 × -8 1 × -8 1 × -8 1.0625 мкг/мышь 10, 11, 12, 13, 14, 15
.
ЭД 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МКФ-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,
10
2 × 10 -10 2 × 10 -9 ND 14
ЕВ 1089 5 × 10 -11 0,5 мкг / кг 12
1 × 10 -10 6 мкг / мышь 11
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
1 × 10 -12 1 × 10 -10 0,0125 мкг / мышь 13
1,25 (ОН) 2 D 3 1 × 10 -8 1 × 10 -7 0,0625 мкг/Mouse 9097 0,0625 мкг.
Соединения . ЭД 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МКФ-7 .
2 × 10 -10 4 × 10 -10 0,01 мкг / мышь 10
2 × 10 -10 2 × 10 -9 Н.Д. 14
5 × 10 -11 0.5 мкг / кг 12
1 × 10 -10 6 мкг / мышь 11
2 × 10 — 10 6 × 10 -10 0,00125 мкг / мышь 15
1 × 10 -12 1 × 10 -10 0,0125 мкг / мышь 13
1,25 (OH) 2 D 3 1 × 10 -8 1 × -8 1 × -8 1 × -8 1 × -8 1 × -8 1 × -8 1.0625 мкг/мышь 10, 11, 12, 13, 14, 15

Мы исследовали рост волос голых мышей, получавших либо разбавитель (контрольные мыши), либо 1,25(ОН) 2 D 3 или один из пяти аналогов витамина D 3 . В каждой группе было по три мыши. Влияние аналогов витамина D 3 на рост шерсти голых мышей систематически оценивали для каждой мыши, присваивая им баллы по шкале от 1 до 10 (таблица 1) три раза в неделю. Оценка роста волос учитывает толщину и пигментацию кожи, потому что это косвенно коррелирует с индукцией анагена, которая является фазой роста цикла роста волос.Например, 5 баллов представляют собой утолщение кожи с сильной пигментацией, что отражает формирование волосяного стержня до выпячивания волос над поверхностью кожи. Время до появления волос и балльные оценки варьировались от мыши к мыши и среди аналогов витамина D 3 (рис. 4).

Рисунок 4.

Влияние соединений витамина D 3 на рост волос у бестимусных мышей. Мышей обрабатывали соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1.На каждой панели показаны репрезентативные эксперименты. Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P < 0,05 для самок мышей, представленных в F.

Рисунок 4.

Влияние соединений витамина D 3 на рост волос у бестимусных мышей. Мышей обрабатывали соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1. На каждой панели показаны репрезентативные эксперименты.Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P < 0,05 для самок мышей, представленных в F.

Максимальная оценка роста волос была постоянно выше у мышей, получавших аналоги витамина D 3 , чем у контрольных мышей (таблица 4). Соединения KH 1060, Ro 27-5646 и EB1089 были наиболее последовательно эффективными в отношении стимулирования роста волос. 1,25(ОН) 2 D 3 мало влияли на рост волос (табл. 4, рис.4). Время достижения максимального роста волос различалось в группах лечения витамином D 3 . Например, латентный период составлял в среднем 9 дней для мышей, получавших либо Ro 27-0574, либо EB1089 (самки), тогда как он составлял 18 дней для самцов, получавших EB1089, и 21 день для мышей, получавших KH 1060 (рис. 4). ). Быстрое выпадение волос вернуло баллы к исходному уровню в течение 4 дней, даже несмотря на то, что лечение аналогом витамина D 3 не было прекращено. Второй цикл роста волос (пиковая оценка, 7–8) произошел в группах лечения Ro 25-9022, Ro 27-0574 и EB1089 примерно через 19 дней после первого цикла.Мы также исследовали способность EB1089 стимулировать рост волос у самцов и самок мышей. У обоих была стимуляция волос; первый пик роста волос у самок немного опережает пик у самцов (рис. 4Е).

Таблица 4.

Сводка самых высоких показателей волос, полученных голыми мышами, получавшими витамин D 3 аналоги

7
. Управление . 1,25(ОН) 2 Д 3 . Ро 25-9022 . КХ 1060 . Ро 27-0574 . Ро 27-5646 . EB1089 .
Мужчина . Женщина . 90 964
Самый высокий средний балл 5 5 8 8 8 8 7 7
4 5 7 6. 5 7 8 7
3 4 8 6 8 6 4
Среднее 4.00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
сд 1,00 0,58 0,58 1,15 1,73 1,00 2,08 0.00
Р значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
7
. Управление . 1,25(ОН) 2 Д 3 . Ро 25-9022 . КХ 1060 . Ро 27-0574 . Ро 27-5646 . EB1089 .
Мужчина . Женщина . 90 964
Самый высокий средний балл 5 5 8 8 8 8 7 7
4 5 7 6. 5 7 8 7
3 4 8 6 8 6 4
Среднее 4.00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
сд 1,00 0,58 0,58 1,15 1,73 1,00 2,08 0.00
Р значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01 
Таблица 4.

Сводка самых высоких показателей волос, полученных голыми мышами, получавшими витамин D 3 аналоги

7
. Управление . 1,25(ОН) 2 Д 3 . Ро 25-9022 . КХ 1060 . Ро 27-0574 . Ро 27-5646 . EB1089 .
Мужчина . Женщина . 90 964
Самый высокий средний балл 5 5 8 8 8 8 7 7
4 5 7 6. 5 7 8 7
3 4 8 6 8 6 4
Среднее 4.00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
сд 1,00 0,58 0,58 1,15 1,73 1,00 2,08 0.00
Р значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
7
. Управление . 1,25(ОН) 2 Д 3 . Ро 25-9022 . КХ 1060 . Ро 27-0574 . Ро 27-5646 . EB1089 .
Мужчина . Женщина . 90 964
Самый высокий средний балл 5 5 8 8 8 8 7 7
4 5 7 6. 5 7 8 7
3 4 8 6 8 6 4
Среднее 4.00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
сд 1,00 0,58 0,58 1,15 1,73 1,00 2,08 0.00
Р значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01 

РНК и белок были выделены из одних и тех же образцов кожи с наивысшим баллом около 8, у мышей, получавших EB1089 и Ro 25-9022, и у мышей, получавших 1,25(OH) 2 D 3 или контрольный разбавитель. кДНК была получена и амплифицирована для экспрессии генов кератина. Экспрессия мРНК кератина по-разному регулировалась в коже животных, получавших аналог витамина D 3 (рис. 5). 1,25(OH) 2 D 3 увеличивал экспрессию мРНК Ha1, но не влиял на уровни каких-либо других исследованных кератинов (рис.5, А и Б). Кожа мышей, получавших либо EB1089, либо Ro 25-9022, показала значительно повышенную экспрессию мРНК ( P <0,05) кератинов Ha1, Ha7, Ha8 и Hb3. Экспрессия На4 существенно не увеличивалась ни при каком лечении. Экспрессию кератинов Hb3 и Ha8 определяли на уровне белков с помощью вестерн-блоттинга (рис. 6). В соответствии с результатами ПЦР уровни Hb3 и Ha8 были повышены в коже мышей, получавших Ro 25-9022 и EB 1089, но не у мышей, получавших 1,25(OH) 2 D 3 .

Рисунок 5.

A, Влияние аналогов витамина D 3 на экспрессию мРНК кератина в коже бестимусных мышей. A, ОТ-ПЦР-анализ РНК, полученной из кожи мышей, получавших контрольный разбавитель, 1,25(OH) 2 D 3 или аналоги витамина D 3 . кДНК с обратной транскрипцией подвергали ПЦР-амплификации с использованием наборов праймеров, специфичных для кератинов, в течение 35 циклов или 18S РНК в течение 25 циклов. B, цифровой количественный анализ сигналов для пяти кератинов, как показано на A.Относительную экспрессию кератина определяют путем нормализации до уровня 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, Р < 0,05.

Рисунок 5.

A, Влияние аналогов витамина D 3 на экспрессию мРНК кератина в коже бестимусных мышей. A, ОТ-ПЦР-анализ РНК, полученной из кожи мышей, получавших контрольный разбавитель, 1,25(OH) 2 D 3 или аналоги витамина D 3 .кДНК с обратной транскрипцией подвергали ПЦР-амплификации с использованием наборов праймеров, специфичных для кератинов, в течение 35 циклов или 18S РНК в течение 25 циклов. B, цифровой количественный анализ сигналов для пяти кератинов, как показано на A. Относительную экспрессию кератина определяют путем нормализации до уровней 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, Р < 0,05.

Рисунок 6.

Влияние аналогов витамина D 3 на экспрессию белков кератина волос.Вестерн-блот последовательно исследовали антисыворотками против Hb3 и На8, а также глицеральдегид-3-фосфатдегидрогеназой (контроль загрузки).

Рисунок 6.

Влияние аналогов витамина D 3 на экспрессию белков кератина волос. Вестерн-блот последовательно исследовали антисыворотками против Hb3 и На8, а также глицеральдегид-3-фосфатдегидрогеназой (контроль загрузки).

Для выяснения того, является ли эффект стимуляции роста волос аналогами витамина D 3 специфичным для голых мышей, мышам C57 BL/6 давали либо Ro 25-9022, либо Ro 26-9114 три раза в неделю после отрастания волос. стимулировали выщипыванием волос.Волосы оценивали три раза в неделю по той же шкале, что и в таблице 1. Во время лечения любым из аналогов витамина D 3 ускорение роста волос не наблюдалось (рис. 7).

Рисунок 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL/6. Мыши C57 BL/6 получали контрольный разбавитель, Ro 26-9114 или Ro 25-9022, три раза в неделю, начиная со дня выщипывания шерсти.Оценка волос проводилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение для восьми мышей.

Рисунок 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL/6. Мыши C57 BL/6 получали контрольный разбавитель, Ro 26-9114 или Ro 25-9022, три раза в неделю, начиная со дня выщипывания шерсти. Оценка волос проводилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение для восьми мышей.

Обсуждение

Волосяные фолликулы непрерывно проходят три фазы (рассмотрено в Ref.18): фаза роста (анаген), стадия инволюции (катаген) и период покоя (телоген). Молекулярные сигналы, контролирующие переход фолликулов между этими стадиями, до конца не изучены. На рост волос влияют различные гормоны, в том числе эстроген, гормон роста и андрогены (19, 20). Андрогены могут способствовать миниатюризации фолликулов и сокращению продолжительности стадии анагена. Напротив, эстроген может продлить стадию анагена.

Стимуляция роста волос является так называемым святым Граалем, к которому стремятся многие ученые, особенно в фармацевтических компаниях.На рынке имеется несколько препаратов, стимулирующих рост волос, в том числе миноксидил и финастерид (21, 22). Миноксидил продлевает стадию анагена роста волос и вызывает увеличение и рост фолликулов в состоянии покоя. Он удлиняет и увеличивает мелкие пушковые волосы и уменьшает выпадение волос (21). Как он опосредует эти эффекты, неясно. Финастерид является ингибитором 5-альфа-редуктазы 2 типа, который снижает уровень дигидротестостерона в сыворотке и коже и, следовательно, ингибирует андрогензависимую миниатюризацию волосяных фолликулов (22).

Мыши с нокаутом рецептора витамина D характеризуются устойчивым к 1,25(OH) 2 D 3 рахитом с гипокальциемией, гипофосфатемией, гиперпаратиреозом, рахитом, остеомаляцией и алопецией (6, 23, 24). Помещение этих животных на диету с высоким содержанием кальция, фосфора и лактозы может нормализовать их фенотип, за исключением алопеции (23, 25). Более того, люди с устойчивым к витамину D 3 рахитом 2 типа имеют зародышевую инактивирующую мутацию VDR с частичной или полной алопецией (26).Исследования с использованием мышей с нокаутом VDR показали, что кератиноциты являются аберрантными клетками, ответственными за их безволосый фенотип (23, 27). Кератиноциты экспрессируют Whn, и анализы восстановления волос показали, что они являются дефектным типом клеток в развитии волос голых мышей (2). Исследования показали, что экспрессия нескольких генов кератина снижена в обнаженной коже и что транскрипция генов кератина может регулироваться Whn (4, 28). В наших исследованиях мы показали, что лечение голых мышей аналогами витамина D 3 повышало экспрессию кератинов в их коже одновременно с ростом волос.Эти наблюдения позволяют предположить, что аналоги витамина D 3 временно действуют, нормализуя кератиноциты голых мышей, что способствует образованию волос.

Выщипывание волос вызывает начало новой фазы анагена волосяного фолликула. Наши эксперименты на мышах линии C57 BL/6 показали, что аналоги витамина D 3 не влияли на повторное появление волос после выщипывания. Это наблюдение предполагает, что аналоги витамина D 3 не влияют на индукцию анагена. Аналоги витамина D 3 , по-видимому, действуют после Whn, о чем свидетельствует их способность повышать экспрессию мРНК генов-мишеней Whn, кератина Ha1, Ha7, Ha8 и Hb3, в коже голых мышей.Ранее было показано, что 1,25(OH) 2 D 3 повышает экспрессию кератина во время дифференцировки кератиноцитов (29), хотя этот эффект был косвенным (30). В кератиноцитах Whn экспрессируется на ранних стадиях терминальной дифференцировки, где он активирует маркеры ранней дифференцировки, такие как кератин 1 (4, 31). Наши наблюдения на бестимусных мышах позволяют предположить, что лечение аналогами витамина D 3 способно преодолеть блокаду дифференцировки кератиноцитов, вызванную инактивацией Whn, что приводит к увеличению экспрессии кератина и образованию видимых волос.

Недавнее исследование показало, что у пациента с мутацией VDR наблюдается алопеция, неотличимая от атрихии, вызванной мутациями в гене безволосости (32). Авторы пришли к выводу, что VDR и ген безволосости могут быть частью одних и тех же или конвергентных генетических путей, необходимых для нормального цикла роста волос. У бесшерстных мышей аберрантный фенотип вызывается дефектом катагена (33). Это повышает вероятность того, что аналоги витамина D 3 могут регулировать экспрессию генов, контролирующих катаген.

В наших экспериментах введение 1,25(OH) 2 D 3 не вызывало роста волос у голых мышей; однако ряд аналогов витамина D 3 вызывали рост волос. Ранее было показано, что все эти аналоги обладают большей способностью индуцировать дифференцировку и ингибировать пролиферацию различных типов клеток, связанных с раком, как in vitro , так и in vivo (10–15) (таблица 3). Таким образом, вероятной причиной того, что аналоги витамина D 3 способны стимулировать рост волос у бестимусных мышей, тогда как 1,25(OH) 2 D 3 нет, является то, что они обладают большей эффективностью in vivo .Каждый из аналогов способен связываться с VDR (9). Некоторые из механизмов, которые, как предполагается, объясняют их повышенную эффективность, включают тот факт, что они уменьшают связывание с D-связывающим белком в сыворотке, что обеспечивает более легкий доступ к клетке. Эти аналоги могут изменять конформацию VDR, делая их более активными, или они могут продлевать период полувыведения активированного VDR (34). Они также могут модулировать способность корепрессоров или коактиваторов взаимодействовать с активируемым лигандом VDR (35).Каким бы ни был механизм, эти аналоги действуют на волосяные фолликулы голых мышей, вероятно, путем стимуляции экспрессии генов, таких как кератины, которые расположены ниже дефектного транскрипционного фактора Whn; и эти гены имеют решающее значение для формирования стержня волоса (16, 17, 31). Таким образом, наши результаты убедительно доказывают, что аналоги витамина D 3 могут стимулировать рост волос у бестимусных мышей, которые обычно не имеют видимых волос.

Благодарности

Эта работа была частично поддержана семейным фондом Сида и Энн Шварц, Фондом Хорна и Фондом Паркера Хьюза.Х.П.К. заведует кафедрой онкологии Марка Гудсона в Медицинском центре Cedars Sinai и является членом Онкологического центра Йонссона.

Сокращения

  • BNX

  • 125 (ОН) 2 Д 3

  • РДР

1

Nehls

М

,

Пфайфер

D

,

Schorpp

М

,

Hedrich

H

,

Boehm

T

1994

Новый член семейства белков с крылатой спиралью, разрушенный в результате голых мутаций мыши и крысы

.

Nature

372

:

103

107

2

Brissette

JL

,

LI

J

,

Kamimura

J

,

,

,

,

,

,

,

,

.

1996

Продукт локуса мыши nude, Whn, регулирует баланс между ростом и дифференцировкой эпителиальных клеток

.

Genes Dev

10

:

2212

2221

3

Frank

J

,

Pignata

С

,

Пантелеев

А.А.

,

Прауз

ДМ

,

Баден

Н

,

Веинер

л

,

Gaetaniello

л

,

Ахмад

W

,

Pozzi

N

,

Cserhalmi-Фридман

РВ

,

Aita

В.М.

,

Uyttendaele

H

,

Gordon

D

,

OTT

J

,

Brissette

JL

,

Christiano

1999

, выявляя человеческий обнаженный фенотип

.

Природа

398

:

473

441

4

Schorpp

М

,

Schlake

Т

,

Kreamalmeyer

D

,

Аллен

PM

,

Бем

Т

2000

Генетически разделяемые детерминанты экспрессии генов кератина волос

.

Дев Dyn

218

:

537

543

5

Schlake

Т

,

Schorpp

М

,

Nehls

М

,

Бем

Т

1997

nude ген кодирует специфичный для последовательности ДНК-связывающий белок с гомологами в организмах, у которых отсутствует упреждающая иммунная система

.

Proc Natl Acad Sci USA

94

:

3842

3847

6

Йошизава

Т

,

Ханда

Да

,

Уемацу

Да

,

Такеда

S

,

Секине

К

,

Есихара

Да

,

Каваками

Т

,

Arioka

К

,

Сато

Н

,

Учияма

Да

,

Masushige

S

,

Fukamizu

A

,

Matsumoto

T

,

Kato

S

1997

У мышей, лишенных рецептора витамина D, наблюдается нарушение формирования костей, гипоплазия матки 30 после отъема и задержка роста 9.

NAT Genet

16

:

391

396

7

Reichrath

J

,

Schilli

M

,

Kerber

A

,

Bahmer

FARBER

A

,

Bahmer

FARBER

A

,

BAHMER

FARBER

A

.

,

Paus

R

1994

Экспрессия рецепторов 1, 25-дигидроксивитмина D в волосяных фолликулах 3 рецепторов во время цикла роста волос у мышей

.

BR J Dermatol

131

:

477

482

8

Bikle

DD

,

GEE

E

,

Pillai

S

1993

. метаболизм витамина D аналогами 1,25-дигидроксивитамина D3

.

J Invest Dermatol

101

:

713

718

9

Бульон

R

,

Окамура

WH

,

Norman

1995

Структурно-функциональные отношения в витамин D Эндокринная система

.

Endocr Rev

16

:

200

257

10

Hisatake J

,

О’Келли J

,

Uskokovic

М

,

Tomayasu

S

,

Koeffler

HP

2001

Новый витамин D 3 аналог, 21-(3-метил-3-гидроксибутил)-19-нор-D 3 , который модулирует клеточный рост, дифференцировку, апоптоз, клеточный цикл и индукция PTEN в лейкемических клетках

.

Кровь

97

:

2427

2433

11

Shiohara

М

,

Uskokovic

М

,

Hisatake

J

,

Hisatake

Да

,

Койке

К

,

Komiyama

A

,

Koeffler

HP

2001

24-оксометаболиты аналогов витамина D3: диссоциация их выраженного противолейкозного действия из-за отсутствия у них модуляции кальция 90.

Cancer Res

61

:

3361

3368

12

LEE

YY

,

KIM

ES

,

SEOL

JG

,

KIM

BK

.

Elstner

E

,

Park

DJ

,

Koeffler

HP

1996

Эффект витамина D 3 Analog, EB1089, на гемтопейтическую Stem -Cltra and MyElice -LekEm.

Лейкемия

10

:

1751

1757

13

Elner

E

,

Linker-Israeli

M

,

сказал

J

,

,

,

J

,

,

j

,

,

,

.

S

,

Shintaku

IP

,

Heber

D

,

Binderup

L

,

USKOKOVIC

M

,

Koeffler

HP

595995

9000. 3 Аналоги : новый класс сильнодействующих ингибиторов пролиферации и индукторов дифференцировки клеточных линий рака молочной железы человека

.

Cancer Res

55

:

2822

2830

14

Койка

М

,

Koshisuzuka

К

,

Sawabata

Н

,

Ян

R

,

Тауба

ОН

,

сказали

J

,

USKOKOVIC

M

,

TSURUOKA

N

,

Koeffler

HP

1999

20-й-циклопил-хол-хол-хол. мощные ингибиторы пролиферации клеточных линий предстательной железы, молочной железы и миелоидного лейкоза человека

.

Антираковая Res

19

:

+1689

1 698

15

Kubota

Т

,

Koshizuka

К

,

Койке

М

,

Uskokovic

М

,

Миёси

Я

,

Koeffler

HP

1998

19-нор-26, 27-бишомо-витамин D 3 аналоги: уникальный класс сильнодействующих ингибиторов пролиферации раковых клеток предстательной железы, молочной железы и гемопоэтических клеток.

Cancer Res

58

:

3370

3375

16

Роджерс

М.А.

,

зима

Н

,

Вольф

С

,

Хека

М

,

Schweizer

Дж

1998

Характеристика 190-килопарного домена генов кератина волос человека I типа

.

J Biol Chem

273

:

26683

26691

17

Лангбейн

L

,

Роджерс

М.А.

,

зима

Н

,

Praetzel

S

,

Schweizer

J

2001

Каталог кератинов волос человека.II. Экспрессия шести представителей типа II в волосяном фолликуле и комбинированный каталог кератинов типа I и II человека

.

J Biol Chem

276

:

35123

35132

18

Фукса

Е

,

Меррилл

BJ

,

Джамора

С

,

DasGupta

R

2001

У истоков бесконечного цикла

.

Дев Сотовый

1

:

13

25

19

Sawaya

ME

,

Penneys

NS

+1992

иммуногистохимическое распределение ароматазы и 3B-гидроксистероиддегидрогеназы в фолликуле человеческих волос и сальных сальник

.

J Cutan Pathol

19

:

309

314

20

Hodgins

MB

,

MURAD

S

1986

25-DihydroxyChaleCaLECFEROLOLOLOLOLOLOLOLOLOLOLOLIN культура

.

J Эндокринол

110

:

R1

R4

21

Дюшарм

DW

,

Freyburger

WA

,

Грэхэе

BE

,

Карлсон

RG

тысячу девятьсот семьдесят три

Фармакологических свойства миноксидила: новое гипотензивное средство

.

J Pharmacol Exp Ther

184

:

662

670

22

McClellan

KJ

,

Markham

A

1999

Финастид: обзор его использования в мужской картине

: Обзор его использования в мужском рисунке

: Обзор. Использование в мужской картине

: Обзор. Использование в мужской картине

: Обзор. Использование. .

Препараты

57

:

111

126

23

Sakai

Y

,

Kishimoto

J

,

Demay

MB

MetaboLIL и Cellecila DITAMINECILEALERINE ALATAMINECILEALERINE ALATAMINECILEALIMALIRIN мыши с нокаутом рецептора

.

J Clin Invest

107

:

961

966

24

Ли

YC

,

Пирро

АЕ

,

Amling

М

,

Деллинг

G

,

Барон

R

,

Bronson

R

,

Demay

MB

1997

Целенаправленная абляция рецептора витамина D: модель витамин D-зависимого рахита II типа на животных с алопецией 9003.

Proc Natl Acad Sci USA

94

:

9831

9835

25

Ли

YC

,

Amling

М

,

Пирро

АЕ

,

Priemel

М

,

Meusse

J

,

Baron

R

,

Delling

G

,

DEMAY

MB

1998

Чертилизация минерального ионного гомеостаза по диетическим средним. Мыши с удаленным рецептором витамина D

.

Эндокринология

139

:

4391

4396

26

HEWISON

M

,

O’RIORDAN

JLH

1994

VITAMIN DOSTANCENANCE

.

Baillieres Clin Endocrinol Metab

9

:

305

315

27

Чен

СН

,

Сакаи

Да

,

Demay

MB

2001

Targeting выражение витамина человека Рецептор D к кератиноцитам мышей с нулевым рецептором витамина D предотвращает алопецию

.

эндокринологии

142

:

5386

5392

28

Schlake

Т

,

Schorpp

М

,

Маул-Pavicic

,

Малашенко

А.М.

,

Бем

T

2000

Фактор транскрипции вилкообразной/крылатой спирали Whn регулирует экспрессию гена кератина волос: молекулярный анализ фенотипа обнаженной кожи

.

Дево Dyn

217

:

368

376

29

Hosomi

J

,

Hosoi

J

,

Эйб

Х

,

Suda

Т

,

Курков

Т

1983

Регуляция терминальной дифференцировки культивируемых эпидермальных клеток мыши с помощью 1,25-дигидроксивитамина D3

.

эндокринологии 113

:

1950

1957

30

Блуменберг М

,

Коннолли ДМ

,

Freedberg

ИВ

1992

Регулирование экспрессии генов кератина. Роль ядерных гормональных рецепторов для ретиноевой кислоты, гормона щитовидной железы и витамина D3

.

J Invest Dermatol

98

:

42

S — 49S31

Baxter

RM

,

Brissette

JL

2002

Роли обнаженного гена в Epiteleial TranceLicate.

J Invest Dermatol

118

:

303

309

32

Миллер

J

,

Djabali

К

,

Чен

Т

,

Лю

Да

,

Ioffreda

M

,

Lyle

S

,

Christiano

AM

,

Holick

M

,

COTSARELIS

G

2001

Atrichia, вызванный мутациями в vitamin d -receptor Gene. атрихия, вызванная мутациями в гене безволосости

.

J Invest Dermatol

117

:

612

617

33

Пантелеев

А.А.

,

Бочкарева

Н.В.

,

Сандберг

JP

,

Кристиано

А.М.

,

Паус

R

1999

Роль гена безволосости (hr) в регуляции катагенной трансформации волосяных фолликулов

.

Am J Pathol

155

:

159

171

34

ван ден Bemd

ГХ

,

Pols

HA

,

Birkenhager

JC

,

Ван Leeuwen

JP

1996

Конформационное изменение и усиленная стабилизация рецептора витамина D с помощью аналога 1,25-дигидроксивитамина D3 KH 1060

.

PROC NATL ACAD SCI USA

93

:

10685

10690

35

Campbell

MJ

,

Koeffler

HP

1997

к TherapeTic Antry of CoundINIINEN.

J Natl Cancer Inst

89

:

182

186

Copyright © 2002 Эндокринное общество

лучших добавок для восстановления роста и истончения волос

Истончение волос — одна из самых неприятных проблем красоты, и, несмотря на то, что инвестиции в местные процедуры, такие как богатые белком средства для укрепления связей, кондиционеры глубокого действия и сыворотки для питания кожи головы, являются неотъемлемой частью поддержания (или восстановления) полной гривы, иногда решение проблемы изнутри — лучший способ действий.Если вы только что сделали слишком короткую стрижку или испытываете истончение волос из-за стресса, гормонов или естественного процесса старения, защитите себя твердой добавкой для роста волос. без радикальных мер, таких как лазерная терапия или дорогостоящее наращивание. Чуть больше года назад я пошел к новому стилисту с намерением уйти с тонкой стрижкой и несколькими слоями для обрамления лица, а вместо этого вышел из салона (кстати, в слезах) с совершенно нежелательными кефаль.Для справки, это была не крутая стрижка шег — это была пограничная стрижка быком, которую не мог исправить руками другой профессионал, не сбрив полностью все мои волосы. Хотя это определенно был вид , это был определенно , а не вид, к которому я стремился.

Естественно, я впал в режим полной паники, поэтому я немедленно начал рыскать по сети, отчаянно ища способы ускорить мою обреченную судьбу в долгом путешествии по восстановлению роста волос. Послушайте, я по натуре скептически отношусь к косметическим брендам, которые делают громкие заявления о том, на что способны их добавки, но в этот момент я был готов попробовать что угодно.Я попробовал несколько разных формул и в конечном итоге пришел к выводу, что Nutrafol является наиболее эффективным, но есть и другие надежные варианты, если вы не можете проглотить ценник.

Конечно, плохая стрижка — это только одна из причин непреднамеренной потери волос, но, как уже упоминалось, истончение волос может быть вызвано множеством других факторов, от диеты до стресса, генетики и даже гормонального дисбаланса. Во время моего стремления получить знания о том, на какие витамины действительно стоит потратить деньги на моем пути к выздоровлению, я узнал, что есть несколько убедительных и научно обоснованных активных ингредиентов, связанных с ускорением повторного роста волос.Хотя я, по общему признанию, всегда придерживался мнения, что витамины красоты якобы являются полной уловкой, а не реальным решением, я счастлив сказать, что теперь я верю. Биотин является золотым стандартом, который следует искать, когда вы ищете эффективную пероральную добавку для волос, но есть много менее известных витаминов и растительных компонентов, которые, как было обнаружено в клинических исследованиях, ускоряют рост волос. Некоторые многообещающие ингредиенты, которые следует искать при оценке различных формул, включают Saw Palmetto, железо и адаптогены, модулирующие стресс, такие как ашваганда.Вот несколько хороших вариантов, которые я лично рекомендую, которые обязательно помогут восстановить объем, блеск и длину с течением времени.

Наша миссия в STYLECASTER — нести стиль людям, и мы представляем только те продукты, которые, как мы думаем, вам понравятся так же сильно, как и нам. Обратите внимание, что если вы покупаете что-то, нажав на ссылку в этой истории, мы можем получить небольшую комиссию от продажи.

Мантра STYLECASTER — «Стиль для людей», а наша миссия — быть доступным, инклюзивным и опережающим трендом местом для миллениалов и женщин поколения Z, которые хотят жить со стилем и содержанием.Наши материалы о моде, красоте и образе жизни в равной степени информативны и вдохновляют, и в то же время желательны, но достижимы. Если вы покупаете независимо проверенный продукт или услугу по ссылке на нашем веб-сайте, мы можем получить партнерскую комиссию.

1. Витамины для волос Nutrafol

Амазон.

Эта добавка для волос содержит набор ключевых ингредиентов, способствующих росту волос, включая ашваганду, морской коллаген и биотин. Это также подкреплено впечатляющими клиническими данными.Во время исследования 80% опрошенных женщин сообщили о более густых и длинных волосах.

2. Hair Anew Healthy Hair Formula

Амазон.

Эти добавки для роста волос содержат комплекс сильнодействующих активных ингредиентов, таких как биотин, бурые водоросли, диоксид кремния и экстракт хвоща, которые способствуют более густой гриве при постоянном использовании.

3. Добавка для волос Viviscal Extra Strength

Амазон.

Эта высокоэффективная и клинически доказанная добавка для волос содержит смесь ингредиентов (включая их морской комплекс), разработанных для ускорения роста существующих волос.

.

Добавить комментарий

Ваш адрес email не будет опубликован.