Какой витамин отвечает за волосы: Какие витамины для волос от выпадения, роста, укрепления волос

Содержание

Витамины от выпадения волос - L’officiel

Красивые, густые волосы — не только генетика, но и другие факторы: питание, уход и витамины. Как правильно выбрать добавки, рассказывает трихолог-реабилитолог Анастасия Мухачева. 

Волосы могут рассказать о жизни человека. В этом смысле волосяной стержень похож на киноленту, которая состоит из множества отдельных кадров. Каждый день клетки добавляются в основании волоса, и волосяной стержень чуть-чуть поднимается. Эта новая клетка содержит описание здоровья владельца волос в этот конкретный день. Клетки волосяной луковицы будут содержать химические элементы из крови, так как луковица получает питание по мелким кровеносным сосудам, окружающим её основание. Питательные вещества и молекулы O₂ поступают в них от фолликула, расположенного в дерме. В нем происходит огромное количество биохимических реакций, поддерживающих здоровье волос. Все они активизируются и протекают в присутствии витаминов и других органических соединений. Насколько важны витамины при сильном выпадении волос и для здорового состояния кожи?

Причины выпадения волос

Внутренними причинами выпадения волос принято считать:

  • Дефицит витамина D3, а точнее гормона.
  • Дефицит половых гормонов.
  • Нарушение секреции гормонов щитовидной железы.
  • Дефицит йода.
  • Дефицит железа (ферритина и витамина В12).
  • Ожирение и сопровождающая его инсулинорезистентность.
  • Дефицит или излишек кортизола (гормона стресса).
  • Интоксикации (в том числе и лекарствами).
  • Вирусные и бактериальные инфекции в сопровождении высокой температуры.
  • Нарушение режима сна и отдыха.
  • Несбалансированное питание.

Витамины против выпадения волос — B₂, B₃, B₅, B₆, H, B₉, C, A, E.

Витамин B₂

Какие нужно выбирать витамины при выпадении волос? Рибофлавин активизирует приток крови к фолликулам, что улучшает поступление к ним органических веществ и молекул кислорода. При дефиците концы волос становятся сухими, а корни — жирными.

Витамин B₃

Никотиновая кислота нормализует обмен веществ в волосяных луковицах. Ее недостаток делает волосы сухими и замедляет их рост.

Витамин B₅

Пантотеновая кислота отвечает за кровообращение и обмен веществ в коже головы. Она делает волосы прочными, сильными и блестящими. При ее недостатке волосы быстро седеют и явно замедляют свой рост.

Витамин B₆

Пиридоксин стимулирует обмен веществ на молекулярном уровне. При его недостатке нарушается микробиом кожи головы, появляется ощущение зуда, перхоть, выпадение волос.

Витамин H

Биотин регулирует функционирование сальных желез и метаболизм, делая волосы крепкими и красивыми. Когда его не хватает, локоны становятся сальными.

Фолиевая кислота

Фолаты активируют синтез новых клеток и усиливают действие пантотена. Если пить эти витамины в комплексе, волосы начнут расти быстрее.

Витамин С

Аскорбиновая кислота хорошо улучшает тонус капилляров, являющихся транспортным депо для крови, обогащенной питательными веществами и O₂, по которому она поставляется к фолликулам. При ее дефиците наблюдается умеренная алопеция - повышается интенсивность выпадения волос.

Витамин А

Ретинол делает волосы густыми, упругими, прочными. Нормализуется синтез кожного сала, что способствует устранению себореи и излишней жирности.

 

Витамин Е

Токоферол тормозит выпадение волос благодаря регуляции работы сальных желез, улучшению питания фолликулов и активизации клеток, даже ослабленных. Симптомами его нехватки являются облысение и сильная себорея.

Почему мы недополучаем витамины? Ведь сегодня фрукты, ягоды, овощи и зелень доступны круглый год.

Основная причина — однообразный рацион. На самом деле большая часть витаминов, необходимых волосам, содержится в продуктах животного происхождения, растительных маслах, семечках и орехах. Жесткие диеты, ограничивающие потребление жиров, непродуманное вегетарианское питание, привычка есть на бегу. Очевидно, что все это очень точно описывает пищевые привычки современного мира. Поэтому без сомнений можно сказать: от недостатка витаминов страдают многие из нас. И если вы хотите иметь красивые, сильные и густые волосы, одними масками и шампунями не обойтись — волосы нужно укреплять изнутри, поэтому без витаминов при выпадении волос никак. Можно выбрать витаминный комплекс. 

При выборе витаминов обращайтесь к специалисту. 

Читайте также: Как быстро отрастить волосы: Советы трихолога

Читайте также: Как укрепить волосы в домашних условиях

Читайте также: Рисовая вода для волос: секреты китаянок

ПРИЧИНЫ ДИФФУЗНОЙ ПОТЕРИ ВОЛОС В МОЛОДОМ ВОЗРАСТЕ

Гаджигороева А.Г., Егорова Ю.Ю., Маркова Ю.А.

ООО «Институт Красивых Волос».

В дикой природе полноценное оперение, блестящая шерсть птиц и зверей выполняют ряд важных для выживания функций (теплообмен, защита) и позволяют косвенно судить о здоровье особей. Для людей красивые ухоженные волосы, в первую очередь, являются важной составляющей внешней привлекательности. И если сезонная линька для животных – эволюционный физиологический процесс, направленный на выживание вида, то повышенное выпадение волос для человека – неприятная ситуация, с которой хотя бы раз в жизни сталкивается каждый человек. Большую часть пациентов консультативного приёма трихологов составляют женщины и мужчины молодого репродуктивного возраста. Выпадение волос может быть проявлением широкого круга транзиторных или длительно существующих состояний, а также реализацией генетической предрасположенности. Часто проблемы начинаются исподволь и не сразу заставляют обратиться к специалисту. Периодическое усиление выпадения волос, пациент, как правило, связывает с сезонностью, стрессами, некачественной стрижкой, окрашиванием, шампунем, нехваткой витаминов. Наиболее частым вариантом потери волос является реакционное выпадение; как правило, рост волос восстанавливается самостоятельно через 4-6 месяцев, поэтому с подобным типом потери волос к врачу обращаются не часто. В основном к специалисту обращаются пациенты, обеспокоенные интенсивностью потери волос, длительностью выпадения, неэффективностью самостоятельно принятых мер направленных на прекращение потери волос, а также при заметном снижении густоты волос.

В норме длительность фазы роста волоса на голове составляет 3 – 8 лет. Это время активного деления и дифференцировки матричных клеток волосяного фолликула, что обеспечивает быстрый рост волос в длину, кератинизацию и пигментацию волос. Данные процессы осуществляются благодаря высоким темпам метаболических реакций и энергообмена, что делает активно делящиеся клетки матрикса особенно чувствительными к различным внешним воздействиям, нарушениям гомеостаза. Необходимые для процессов синтеза питательные вещества фолликул получает через сеть капилляров сосочка волоса, воспроизводя основной продукт – серосодержащий белок кератин. При этом сбои поставок «сырья» и нарушения технологических условий и процессов кератинизации могут привести к нарушению качества конечной продукции и перерывам в работе всей фабрики по производству кератина. Механизмы, способные нарушить нормальный цикл роста волоса не всегда ясны, так как реализуются в процессе комплекса межклеточных и внутриклеточных биохимических взаимодействий. Также сложность состоит в оценке воздействия на волосяной фолликул определенных факторов в условиях целого организма.

Наиболее частым вариантом выпадения волос у людей молодого возраста является реакционная диффузная потеря волос, которая может носить острый и хронический, при длительности свыше 6 месяцев, характер. Как правило, такое выпадение является ответом на действие широкого спектра неблагоприятных триггерных факторов, включая стресс, эндокринные нарушения (гипо- и гипертиреоз, гиперпролактинемию), лихорадку различного генеза, прием некоторых лекарственных средств, алиментарную недостаточность. Последствием такого воздействия является преждевременное прерывание анагена и одновременное вхождение в фазу телогена множества волосяных фолликулов. В таком случае, диффузное телогеновое выпадение волос не является самостоятельным диагнозом, а представляет собой один из симптомов патологического состояния. Реакционное выпадение волос возникает спустя 2-3 месяца после воздействия фактора, провоцирующего прерывание фазы роста. Отсроченность выпадения определяется суммой периодов катагена и покоя, составляющих в среднем, соответственно, 2-4 недели и 2-3 месяца.

Одной из доказанных и частых причин реакционного выпадения волос являются нутриентная и общая белково-энергетическая недостаточность питания. Чаще всего это последствия несбалансированной диеты, которуюпациент поддерживает с целью похудения. Для нормального роста волос питание должно быть энергетически полноценным, сбалансированным по макронутриентам (белки, жиры, углеводы), а также обеспечивать поступление необходимых микронутриентов (витаминов, микроэлементов). Различные заболевания желудочно-кишечного тракта, ведущие к нарушениям переваривания и всасывания питательных веществ, также могут быть причиной развития дефицитных состояний.

Одной из важных составляющих рациона, способствующих нормальному росту волос, является достаточное содержание белка. Известно, что стержни волос на 15,9% состоят из серосодержащей аминокислоты цистеина. Образование дисульфидных связей играет важную роль в формировании пространственной структуры кератина – основного белка волоса. Недостаточное поступление с пищей аминокислот, особенно серосодержащих (цистеин, метионин), может привести к выпадению волос, а также ухудшению их качества.

Одной из частых причин диффузного телогенового выпадения волос у женщин молодого репродуктивного возраста является недостаточность железа. Этот микроэлемент участвует во многих важных метаболических процессах в организме, в связи с чем, дефицит железа негативно отражается на функции многих органов и систем. Помимо выпадения и ухудшения качества волос у пациентов может развиться и беспокоить общая слабость, вялость, одышка, тахикардия, сухость кожи, изменения вкуса, обоняния, дистрофия ногтей и другие расстройства. Развитие железодефицита у женщин могут быть связаны с обильными менструациями, а также с повышением потребности в железе во время особых периодов беременности и лактации. Недостаточное поступление железа наблюдается, как правило, с соблюдением диет с целью снижения веса, а также с особенностями пищевого поведения с ограничением животного белка (у вегетаринцев). В таких случаях с целью компенсации поступления микроэлемента показан прием железосодержащих добавок, иногда на постоянной основе. При назначении препаратов железа следует учитывать первоначальный уровень гемоглобина, ферритина и сывороточного железа, а также проводить периодически контроль этих показателей. Стоит помнить, что при длительном приеме препаратов железа возможно развитие недостаточности цинка – не менее важного для нормального роста волос микроэлемента. К дефициту цинка приводят также парентеральное питание и различные заболевания желудочно-кишечного тракта, способствующие нарушению всасывания. Для установления недостаточности цинка проводится определение его уровня в крови.

Важными участниками процессов роста и дифференцировки клеток являются витамины. Недостаточность витаминов группы В (биотин, пантотеновая кислота), может быть причиной гипоэнергетических состояний и способствовать нарушению цикла роста волос, поскольку витамины этой группы являются важными участниками метаболических реакций и дыхательной цепи в качестве коферментов. Двояка роль витамина А – ретинола – в регуляции цикла роста волоса. Известно, что данный витамин необходим для нормальной пролиферации и дифференцировки кератиноцитов, участвует в антиоксидантной защите и иммунном ответе. Однако применение высоких доз ретиноидов при лечении угревой болезни ингибирует пролиферацию кератиноцитов, индуцирует апоптоз клеток матрикса волосяного фолликула и вызывает преждевременное наступление катагена, что проявляется диффузным телогеновым выпадением волос на 2-3м месяце приема препаратов этой группы. В связи с широким применением препаратов изотретиноина в терапии акне и необходимости его длительного курсового приема, данный факт следует учитывать при сборе анамнеза у лиц молодого возраста

Исследования последних лет показали важную роль витамина Д для циклической пролиферации клеток волосяного фолликула и профилактики выпадения волос. Дефицит витамина Д – распространенное в общей популяции явление, особенно при условиях проживания в зоне пониженной инсоляции и недостаточном поступлении витамина с пищей. Субоптимальным уровнем содержания витамина D в организме являются 30-50 ng/ml, оптимальным – 50-80 ng/ml. С целью исключения его дефицита определяют уровень 25-гидрокси-холекальциферола в сыворотке крови. Наличие на клетках волосяного фолликула рецепторов к витамину D определяет возможность развития алопеции при его недостаточности. С целью коррекции его недостаточности назначают вигантол или аквадетрим в соответствующей дозировке.

Истинное диффузное телогеновое выпадение волос представляет собой процесс потери волос без заметного снижения густоты в разных зонах головы. При этом возможно истончение волос в височных зонах с заменой нормальных волос короткими, длиной 3-6 см. Обычно подобная трансформация наблюдается при длительно текущей телогеновой потери волос. При дерматоскопии не удаётся определить какие-либо специфические признаки. Исключение составляет наличие себореи волосистой части головы, признаки которой выявляются в виде жёлтых перипилярных точек. Диагноз ставится на основании pull-теста (ручной эпиляции волос). При положительном тесте в руках у исследователя остаётся до 6 и более волос со светлыми плотными проксимальными кончиками – это луковица телогенового волоса. Для подтверждения диагноза проводится фототрихограмма – количественное определение волос в фазе телогена и анагена с исследованием диаметра волос.

Диффузное телогеновое выпадение волос может проявляться, как самостоятельное заболевание, а может представлять собой начальные признаки андрогенетической алопеции, для которой характерен более специфический характер потери волос с преимущественной редукцией в зоне темени и, обязательно, их истончение. Сравнительная характеристика физических параметров волос в зоне затылка и темени, полученная в результате фототрихограммы, позволит установить диагноз андрогенетической алопеции на ранних этапах её развития. Дерматоскопическими признаками потери волос по женскому типу (син. андрогенетической алопеции) являются признаки истончения волос в области темени и макушки, желтые перипилярные точки (не всегда), а также пустые устья фолликулов. Обнаружение подобных признаков позволяет своевременно назначить этиопатогенетическое лечение, направленное на поддержание активного роста волос и предотвращения миниатюризации фолликулов.

В случае реактивной телогеновой потери волос лечение должно быть направленно на устранение причины, спровоцировавшей выпадение волос, а также на улучшение питания волосяного фолликула. Важно устранить факторы, провоцирующие стрессовые ситуации, а также, при повышенной нервной возбудимости, назначить седативные препараты. Рекомендуется приём поливитаминов, аминокислот, микроэлементов и сосудистых препаратов.

Эффективным методом лечения, применимым в условиях амбулаторного приёма, является мезотерапия. Показания для мезотерапии – как острое, так и хроническое телогеновое выпадение волос. В основе метода – точечная доставка веществ, необходимых для роста волос, в кожу скальпа на глубину 3-4 мм, в места залегания волосяных фолликулов. Механизм активации: рефлексотерапевтический (тонизация биологически активных точек волосистой части головы), фармакопунктурный, нейрогуморальный. При повреждении кожи иглой происходит высвобождение активных медиаторов воспаления (гистамина, катехоламинов, лизосомных ферментов и др), макрофагальные и фибробластические стадии воспалительного процесса ведут к пролиферации эпидермальных клеток камбиальной зоны и закрытию тканевого дефекта. В месте дефекта образуется молодая соединительная ткань, которая затем с помощью фибробластов перестраивается в соответствии с особенностям дермы данного участка ткани. Асептический воспалительный процесс длится от 3- 6 дней, поэтому процедуру не стоит делать чаще 1 раза в неделю. Курс лечения – 6-10 процедур 1 раз в неделю. Мезотерапия улучшает микроциркуляцию, трофику и лимфодренаж кожи скальпа, улучшает структуру волос, ускоряет их рост, увеличивает густоту волос, оздоравливает кожу скальпа и нормализует салоотделение. В состав мезококтейля должны входить вещества, улучшающие микроциркуляцию (лофтон, прокаин, буфломедил), трофику (D- пантенол, пиридоксин, биотин, витамины группы В, аминокислоты). Лимфолитики и препараты с антиоксидантным действием (рутин-мелилото и гинго-билоба, вит Е), олигоэлементы (цинк, селен, кремний). При наличии андрогенетической алопеции – вещества, блокирующие действие 5а-редуктазы (финастерид), а также стимуляторы роста волос (АТФ, миноксидил) .

Прогноз лечения при телогеновом выпадении волос зависит от причины, которая вызвала потерю волос и возможной связи с андрогенетической алопеции. Своевременно начатая терапия даёт удовлетворительные результаты и позволяет контролировать прогресс андрогенетической алопеции в случае сочетанных форм потери волос.

Польза витаминов группы В для волос


Красота и здоровье волос зависит не только от ежедневного внешнего ухода, но и от качества питания. Чтобы волосы были крепкими, им необходим богатый рацион веществ.
Особую пользу волосам приносят ниацинамид (витамин PP) и витамины группы В – они жизненно необходимы нашим волосам.

Ниацинамид обладает высокой биологической активностью. Механизм физиологического действия обусловлен способностью расширять мелкие кровеносные сосуды, тем самым улучшать кровоснабжение волосяных луковиц, что благоприятно сказывается на их состоянии и росте волос.

Витамины группы В также отвечают за активный рост и здоровье волос:

Витамин В1 (тиамин) – приводит в норму работу сальных желез кожи головы, полезен при низкой скорости роста волос и себорее.
Витамин В2 (рибофлавин) – активизирует кровообращение, тем самым обеспечивая нормальное снабжение волосяных луковиц кислородом и питательными веществами. При дефиците витамина В2 корни волос становятся жирными, а кончики - сухими.
Витамин В3 (ниацин) – увлажняет корни волос и профилактирует их выпадение.
Витамин В6 (пиридоксин) – предотвращает появление перхоти, зуда кожи головы и сухости волос. При недостатке этого витамина волосы тускнеют, теряют насыщенность цвета и блеск.
Витамин В8 предохраняет волосы от появления ранней седины, помогает сохранять здоровую структуру волос.
Витамин В12 (цианокобаламин) восстанавливает структуру поврежденных волос и в целом положительно влияет на их состояние.

Ниацинамидом богаты такие продукты, как печень, гречневая крупа, желтки яиц, дрожжи.

Источником различных витаминов группы В служат зерновые продукты, отруби, рис, орехи, семечки, грибы, молочные продукты, сыр, яйца, морепродукты, мясо, рыба, печень, почки, темно-зеленые овощи, зеленый горошек, авокадо, апельсины, бананы, дыни, капуста, морковь, томаты, соя, чечевица, хлеб, кунжутное масло.

В то же время, качество современных продуктов питания, к сожалению, не может гарантировать нам содержания в них ожидаемого количества тех или иных веществ, поэтому поддерживать нужный уровень ниацинамида и витаминов группы В только через корректировку пищевых привычек достаточно трудно. Вероятно поэтому многие пациенты прибегают к добавлению в рацион пищевых добавок. Однако, на данной момент не изучено, какие именно дозировки веществ, полученных не из растительной пищи, а из добавок, являются эффективными и одновременно безопасными, а также насколько целесообразно их потребление при отсутствии подтвержденного дефицита тех или иных нутриентов.

Выходом из сложившейся ситуации становится использование препаратов местного действия – различных дневных и ночных сывороток против выпадения и для роста волос, которые наносятся непосредственно на кожу головы и питают волосяные фолликулы напрямую всем необходимым для их развития.

Выбирайте сыворотки от выпадения волос, содержащие ниацинамид, витамины группы В, а также пептиды.
Избегайте препаратов, содержащих миноксидил.

                                                        Перейти в каталог

Понравилась статья?

Рейтинг 4.5

Голосов (0)

Витамин D – польза для волос

Любая женщина хочет иметь красивые и густые волосы. Поэтому, увидев рекламу нового шампуня, она сразу стремится в магазин. Однако не всегда проблемы с волосами бывают визуальными. В некоторых случаях причиной нарушения вида шевелюры является нехватка каких-либо витаминов и микроэлементов, неправильное питание. Врачи утверждают, что недостаток именно витамина D может негативно сказываться на состоянии локонов. Заказать витаминные препараты вы можете в любое время.

Содержание:

Для чего он нужен

Под названием «Витамин D» объединены несколько веществ, которые отличаются похожим строением и составом. Наиболее известными считаются витамины D2 и D3 – эргокальциферол и холекальциферол соответственно. Группу элементов также нередко называют «солнечными» витаминками. Дело в том, что подобные вещества организм получает не только из продуктов питания, но они образуются в кожном покрове при воздействии на него ультрафиолетовых лучей. Цену витаминных препаратов вы узнаете из нашего каталога.

Для красоты и силы волос очень важно правильное и качественное усвоение кальция в организме. Происходит подобное благодаря витамину D. Данное веществе благоприятно влияет на шевелюру и оказывает следующие действия:

  • Способствует созреванию волосяных луковиц,

  • Укрепляет волосы, предотвращает их выпадение,

  • Сохраняет нормальный уровень влажности кожи головы, предотвращает появление перхоти,

  • Нормализует кровообращение, которое необходимо для роста новых волосков,

  • Придает волосам блеск и гладкость.

При недостатке витамина D отмечается сухость и ломкость волос, сильное выпадение, появление перхоти. Подобные признаки говорят о том, что стоит проверить уровень необходимого вещества в организме. Часто при достатке других элементов, но нехватке витаминаDвозникают разнообразные проблемы с шевелюрой.

Важно не заниматься самолечением, а получить назначение специалиста. Избыток витаминаDтакже негативно сказывается на состоянии всего организма. У человека развиваются болезни желудочно-кишечного тракта, интоксикация, отложение кальция на сосудах, атеросклероз. Поэтому важно строго соблюдать дозировку при приеме дополнительных средств с витамином D. Витаминные препараты в аптеке продаются всегда.

Как применять при проблемах с волосами


Чтобы помочь шевелюре стать красивой важно правильно использовать витамин D. Не всегда можно получить необходимое количество элемента от солнечных лучей, поэтому рекомендуется пересмотреть рацион питания и добавить в него продукты, в которых вещества содержится больше всего. К такой пище относятся:

  • Молоко и кисломолочные продукты,

  • Икра и красная рыба,

  • Зелень, в частности петрушка,

  • Яйца,

  • Семена подсолнечника.

Большое количество данного витамина присутствует печени и мясе рыбы жирных сортов. Нормой в сутки является 12-15 мкг элемента. Ограничений по возрасту и противопоказаний к использованию практически нет, вещество разрешено даже беременным женщинам. Не принимают витамин Dв таком виде, если присутствует непереносимость и аллергические реакции на данный элемент.

Большую пользу для волос оказывает рыбий жир. При приеме в жидком виде рекомендуется выпивать одну ложку раствора в течение хотя бы месяца. В результате по истечении данного срока волосы уже преобразятся, станут блестящими и послушными. Кстати, рыбий жир в настоящее время можно купить в таблетках либо капсулах. Такой прием гораздо удобней и приятней на вкус.

Однако, конечно, наиболее простым способом получения витамина Dявляется пребывание на солнце. Достичь дневной дозы можно, пробыв под рассеянными ультрафиолетовыми лучами примерно 15 минут в легкой одежде. Не следует более длительное время находиться на солнце – это может стать причиной ожогов кожного покрова.

Косметические средства дома

Существует немало косметических средств с содержанием витамина D. Их можно использовать любому человеку, особенно тем, кому прием элемента внутрь недопустим. В домашних условиях можно легко воспользоваться масками собственного изготовления. Самыми простыми являются следующие:

  • Смешать ампулу витамина D, несколько желтков и касторовое масло. Наносят на чистую кожу головы и немного втирают. Курс лечения – 3 недели.

  • В 150 мл нежирного кефира добавляют 15 капель витамина D (масляный раствор), хорошо перемешивают. Распределяют маску по волосам, смывают спустя половину часа с использованием шампуня.

Специалисты рекомендуют использовать маски с данным веществом 1 раз в пару дней на протяжении пары месяцев. Можно добавлять различные растительные масла, они также благоприятно влияют на состояние волос. Держат средства на голове от 30 минут до полутора часов. Регулярное применение подобные масок поможет справиться с проблемами с волосами.

Лекарства


Если нет времени готовить маски особо нет, а употребление продуктов с витаминомDневозможно по каким-либо причинам, то можно воспользоваться готовыми аптечными средствами.

Подобные препараты выпускаются в различных видах – таблетки, ампулы, витаминные комплексы, масляные растворы, капли на водной основе, жевательные пластинки. Наиболее известными средствами являются Мультитабс, Вигантол, Оксидевит, Никомед, Компливит.

Прием лекарственных средств осуществляют во время еды. В основном дозировка в одни сутки составляет 2 таблетки. Длительность подобного лечения может доходить до 5 недель. Чтобы определить дозировку в каждом отдельном случае, требуется обратиться к специалисту. В течение года по разрешению врача можно повторять курсы приема необходимых элементов. 

Косметику с данным витамином рекомендуется использовать в комплексе с лекарственными средствами, в таком случае можно говорить о более быстром и качественном эффекте. Чаще всего подобное вещество используется в масках и бальзамах.

Красивые волосы хочет любая женщина. Важно использовать не только наружные средства, но и укреплять организм изнутри. Недостаток витамина D часто приводит к ухудшению состояния и внешнего вида шевелюры, поэтому специалисты рекомендуют периодически пропивать различные комплексы с данным элементом в составе.



Важные витамины для женской красоты

Наверняка, вы слышали о том, что красота начинается изнутри. Поэтому для максимально долгого сохранения молодости, красоты и здоровья необходимо, чтобы питание было сбалансированным и полноценным, таким, которое обеспечило бы организм всеми необходимыми витаминами и макроэлементами. Лишь в этом случае, вы сможете похвастаться шелковистыми волосами, чистой здоровой кожей, крепкими ногтями и блеском в глазах.

Самыми лучшими витаминами для красоты женщин являются:

Ретинол (Витамин А) ценный витамин для красоты кожи, волос и здоровья глаз. Первыми признаками его нехватки является перхоть, ломкие волосы, ухудшение зрения, сухость кожи. Этот витамин поддерживает оптимальную влажность слизистых и обновляет их. Он оказывает содействие быстрому заживлению ран, обновляет клетки, улучшает синтез коллагена, омолаживает и делает кожу более упругой. Витамин А широко используется в косметологии, он входит в состав всевозможных пилингов, кремов, сывороток и средств против старения.

Витамин А содержится в продуктах с жировой и масляной основой: рыбьем жире, мясе, масле и яйце. Также он присутствует в желтых и оранжевых продуктах в виде про-ретинола, активизирующегося при соединении с жирами. Поэтому очень полезно употреблять насыщенные про-ретинолом перец, тыкву, морковь со сметаной или маслом. Помимо этого витамин А содержится в листовых овощах, помидорах и говяжьей печени.

Витамин B — сюда входит целая группа витаминов. Это очень важные витамины для красоты волос, их дефицит приводит к раннему появлению седины, перхоти, сухости кожи головы, ухудшению роста волос. Помимо обеспечения здоровья шевелюры они поддерживают уровень белка в клетках и дают им энергию, укрепляют и участвуют в регенерации кожных покровов, поддерживают углеводный и жировой обмен.

  • В1 – незаменим при себорее и выпадении волос, он имеется в пивных дрожжах, орехах, пророщенной пшенице, семенах, печени, картофеле.
  • В2 – при его нехватке появляется жирность кожи вокруг носа, угри, шелушения, ранки в уголках рта и выпадение волос. Он присутствует в орехах, молоке, яйцах, почках, печени и языке.
  • В3 – стимулирует обмен веществ, который способствует сохранению стройности. Его нехватка приводит к появлению седины, выпадению волос. Он содержится в отрубях, зеленых овощах, яичном желтке, почках, неочищенных зернах пшеницы и печени.
  • В6 – стимулирует обмен веществ. Его дефицит приводит к дерматитам, шелушению кожи вокруг глаз и носа, выпадению волос и жирной себорее. Он присутствует в пивных дрожжах, бананах, шпинате, сое, фасоли, крупах, отрубях, неочищенных зернах пшеницы, рыбе, постном мясе, печени и перце.
  • В12 – участвует в выработке метионина. Нехватка этого витамина приводит к бледности или желтизне кожных покровов, ухудшению зрения, судорожному подергиванию конечностей, головокружениям. В большом количестве он содержится в продуктах животного происхождения.

Витамин C — аскорбиновая кислота является природным антиоксидантом, который замедляет процессы старения, стимулирует выработку коллагена, влияющего на эластичность и упругость кожи, также он обеспечивает здоровье десен и зубов. При его недостатке появляется шелушение, сухость и бледность кожи, сыпь, мелкоточечные кожные кровоизлияния и синюшность губ. Поэтому это просто незаменимый витамин для женской красоты.

В большом количестве витамин С содержится в плодах шиповника, черной смородине, киви, цитрусовых, квашенной капусте, облепихе, грецких орехах, шпинате, спарже, укропе, петрушке, кабачках, листовом салате, красном перце, зеленом горошке, помидорах.

Витамин D— кальциферол можно назвать солнечным эликсиром. Этот витамин заботится о здоровье зубов и костей, укрепляет ногти и волосы. Его недостаток может привести к повышенной потливости и дерматитам.

Витамин D активируется при воздействии солнечных лучей. Его можно встретить морской рыбе, молочных продуктах, сливочном масле, неочищенных пшеничных зернах, печени и яичном желтке.

Витамин E — токоферол является мощным антиоксидантом, стимулирующим обмен веществ, замедляющим старение и борющимся со свободными радикалами. Витамин Е для красоты просто необходим, он отвечает за женскую привлекательность и сексуальность, участвуя в выработке эстрогенов. Токоферол удерживает влагу в коже и улучшает в ее клетках циркуляцию крови, помогает в регинерации тканей, предотвращает формирование раковых клеток и имеет большое значение для обмена веществ. Его недостаток приводит к дряблости кожи, выпадению и ломкости волос, отекам, преждевременному старению, ухудшению зрения. Как и витамин А его очень часто используют в косметологии, как ингредиент различных косметических средств.

Витамин Е содержится в масленичных культурах – льне, подсолнухе, оливках. Также его можно найти в растительном масле, плодах шиповника, бобовых, яичном желтке, молочных продуктах, пророщенных зернах пшеницы.

 

Майорова Л.Н.

 

какие витамины нужно пить для красоты волос

Для того, чтобы волосы были сильными, крепкими и блестящими, им, конечно же, нужны витамины. Какие именно витамины отвечают за рост и силу волос, разбиралась редакция ХОЧУ.ua.

ЧИТАЙ ТАКЖЕ - Как экономить на косметике без потери качества

Красота волос — неотъемлемая часть красивого образа любой девушки, однако именно они чаще всего страдают от внешнего воздействия. Постоянные окрашивания, укладки, сушки феном, диеты и неправильное питание — все это отражается на состоянии волос. Волосы — весьма прихотливы в получении полезных веществ. Если вдруг что-то пошло не так, они сразу же ответят тусклым видом, или даже выпадением. 

КАКИЕ ВИТАМИНЫ ПОМОГУТ УКРЕПИТЬ ВОЛОСЫ

Витамины — очень важная часть для здоровья и красоты волос. Именно витамины, а точнее, их необходимое количество в организме гарантируют нормальное питание корня волос. А если напитан корень, значит, длина также будет в хорошем состоянии (если, конечно, не проводить дополнительные эксперименты над волосами).

Читать также: Какими полезным свойствами обладает витамин В6

Часто причиной нехватки витаминов в организме становятся диеты (а именно низкокалорийные диеты), период осень-зима (когда мало доступных овощей и фруктов), а также период беременности (когда витамины расходуются на будущего малыша). И именно в эти три периода необходимо обратить особое внимание на содержание в пище следующих компонентов. 

Смотрите также последний выпуск шоу: Мастер шеф 5 сезон 15 выпуск от 02.12.2015

Витамины группы В

Витамины группы В (В1, В2, В5, В6, В9, В12) отвечает за здоровье и красоту волос. Отдельно хочется выделить из данной группы витамин В1, который отвечает за выработку кератина. А именно кератин является строительным материалом для волос. Витамин В2, в свою очередь, отвечает за достаточное питание волосяных луковиц. Витамин В5 — главный в вопросе обмена веществ в волосах. В9 и В12 нужны для нормального роста волос. 

Группу витаминов В можно найти в зерновых, бобовых, крупах, орехах, яйцах. 

Витамин Е

Читать также: Что нужно знать о травах для похудения

Еще одним очень важным витамином для волос является витамин Е. Он восстанавливает нормальное кровообращение в луковицах головы, питает их, защищает волосы от ультрафиолетового излучения. Кроме того, именно витамин Е отвечает за природный блеск волос. Именно поэтому девушкам, которые хотят усилить блеск, рекомендуется принимать витамин Е в паре с набором по уходу для блеска. 

Витамин Е можно найти в растительных маслах, крупах, орехах, зеленых овощах.

Витамин А

Витамин А обеспечивает волосам комплексных уход. Именно благодаря ему ускоряется рост волос, они приобретают блеск, а также выглядят более ухоженными. К слову, именно витамин А отвечает за шелковистость волос. Кроме того, его норма в крови останавливает процесс сечения и ломкости волос (при условии, что ты не будешь дополнительно мучить волосы окрашиванием и укладками).

Витамин А можно найти в рыбе, сливочном масле, твороге, морковке, абрикосах.

Читать также: Звездная диета Ларисы Долиной: как похудеть на 26 килограмм

Если ты не употребляешь тот или иной продукт, или же если находишься в процессе похудения, принимай указанные витамины в виде капсул, курсами.

Автор: Наталия Вересюк

Лучшие витамины и минералы для роста волос

То, что для поддержания здоровья волос нужны протеин и жирные кислоты омега-3, известно каждому. Протеин часто присутствует в составе средств, призванных сделать локоны более плотными. Однако при регулярном использовании масок и кондиционеров с протеином есть риск перестараться: накопление большого количества концентрированного белка в кортексе (корковом слое волоса) приводит к ломкости.

Гораздо эффективнее протеин усваивается через волосяную луковицу, куда попадает по кровеносным сосудам. Большое количество белка содержится в мясе курицы и индейки, яйцах, молочных продуктах, чечевице и греческом йогурте (последний за счет небольшого количества воды в составе содержит на 50 % больше протеина, чем обычный йогурт, и богат витаминами B5 и D).

К приему капсул омега-3 девушки часто прибегают в надежде остановить выпадение волос, но и для регулярного питания волосяных фолликулов эти полиненасыщенные кислоты также будут хороши. Надежные источники омега-3 — лосось (также богатый железом и витамином В12), масло льняного семени, грецкие орехи и облепиха.

Есть и другие, не менее полезные для волос минеральные элементы и витамины.

Цинк

Американский диетолог Дебора Энос относит цинк к важнейшим микроэлементам, отвечающим за нормальный рост волос, и считает, что его недостаток может привести к их активному выпадению. Большое количество цинка содержится в моллюсках и устрицах. Но есть и более простой способ получить необходимый микроэлемент — налегать на чернику, кунжутные и тыквенные семечки, пшеничные и овсяные отруби, кедровые орехи, дикий рис, сушеные тимьян и базилик.

Витамин С

Основная заслуга витамина С состоит в том, что он повышает выработку коллагена, отвечающего за прочность волос. Аскорбиновая кислота в большом количестве содержится в экзотической папайе, сладком и остром перцах, брюссельской капусте, киви. Чтобы избежать даже умеренного дефицита витамина С, советуем ежедневно употреблять продукты, его содержащие. 

Железо и фолиевая кислота

Если, придя к трихологу, вы пожалуетесь на выпадение волос, первым советом будет сдать анализ на уровень ферритина в крови. Именно этот белковый комплекс отвечает за накопление железа в организме. Волосяные фолликулы — главные потребители железа, поэтому при его нехватке именно они страдают в первую очередь.

Даже если у вас нет анемии и уровень гемоглобина в крови в норме, причиной выпадения волос все равно может стать нехватка железа. Возможно, вы пьете много чая или кофе, в которых содержится танин — дубильная кислота, препятствующая нормальному усвоению железа. Белок альбумин, содержащийся в отрубях и яйцах, также не лучшим образом влияет на усвоение железа. А вот благодаря витамину С этот микроэлемент будет усваиваться лучше. Железом богаты гранатовый и яблочный соки, щавель, ржаной хлеб, овсяная каша, мангольд.

Похожая история и с фолиевой кислотой (витамином B9). Помимо того что ее нехватка способствует развитию анемии, она ослабляет и волосяные луковицы. Чтобы этого избежать, вводите в свой рацион шпинат, зеленый горошек, печень, гречку, спаржу и брокколи.

Биотин

Этот витамин группы B ускоряет рост волос и улучшает состояние кожи головы. Биотин участвует в процессах усвоения углеводов, жиров и белков. Последние являются настоящим строительным материалом для волос, качество которых напрямую зависит от количества биотина в организме. Лучший источник этого витамина — арахис. Но нелишним будет увеличить потребление помидоров, цветной капусты и молочных продуктов.

Текст: Юлия Козолий

Витамин D, комплекс B, биотин и др.

Мы включаем продукты, которые, по нашему мнению, будут полезны нашим читателям. Если вы совершаете покупку по ссылкам на этой странице, мы можем получить небольшую комиссию. Вот наш процесс.

Сбалансированная диета, содержащая все 13 незаменимых витаминов, может помочь сохранить здоровье волос.

Хотя нет никаких доказательств того, что отдельные витамины могут способствовать более быстрому росту волос, недостаток определенных витаминов может привести к выпадению волос или к тонким, ломким волосам.Потребление достаточного количества каждого витамина в рационе может помочь сохранить волосы здоровыми.

Исследователи провели исследования того, как следующие питательные вещества могут способствовать росту волос:

  • витамины D
  • витамин E
  • Комплексные витамины группы B

В этой статье содержится некоторая информация о том, как эти и другие витамины могут способствовать сильному и здоровому волосы.

Добавки с витамином D могут не иметь прямой связи с ростом волос, но его дефицит может повлиять на здоровье волос.

В обзоре 2019 года были обнаружены доказательства связи между дефицитом витамина D и очаговой алопецией, которая может приводить к серьезной потере волос. Многие исследования в обзоре обнаружили низкий уровень витамина D у людей с очаговой алопецией. Гнездная алопеция - это аутоиммунное заболевание.

Согласно обзору, некоторые исследования также показывают, что симптомы очаговой алопеции могут быть более серьезными у людей с низким уровнем витамина D.

Однако авторы исследования 2016 года, в котором была собрана информация от 55 929 женщин в Соединенных Штатах, сделали не обнаружили сильной связи между общим потреблением витамина D и выпадением волос при очаговой алопеции.Также мало доказательств того, что витамин D может привести к возобновлению роста волос.

Некоторые исследования показали, что низкий уровень витамина D может быть связан с облысением по женскому типу, которое является наиболее распространенным типом облысения у женщин. Однако необходимы дальнейшие исследования, чтобы подтвердить эту потенциальную связь.

Также необходимы дополнительные исследования, чтобы подтвердить потенциальную пользу витамина D для роста волос.

Получение достаточного количества витамина D

Управление пищевых добавок рекомендует взрослым получать 600 международных единиц (МЕ) или 15 микрограммов (мкг) витамина D в день.

Однако многие эксперты согласны с тем, что эта ежедневная рекомендация, вероятно, слишком занижена для достижения оптимального уровня в крови, который, по мнению большинства экспертов, составляет от 30 до 60 нанограммов на миллилитр (нг / мл).

Люди могут узнать свой уровень витамина D и его дефицит, попросив своего врача сделать анализ крови.

Немногие продукты содержат значительное количество витамина D, но следующие продукты являются одними из лучших источников:

  • рыба, такая как лосось или рыба-меч
  • грибы
  • яичные желтки
  • обогащенный апельсиновый сок
  • обогащенное молоко

Воздействие солнца также необходимо, так как оно позволяет организму вырабатывать витамин D.Однако людям следует помнить о необходимости использования солнцезащитного крема, так как чрезмерное пребывание на солнце со временем может привести к повреждению кожи.

Добавки с витамином D можно купить в Интернете, но перед приемом витаминов человеку всегда следует проконсультироваться со своим врачом.

При этом добавки витамина D относительно безопасны, а токсичность встречается крайне редко.

Однако прием витамина D в очень высоких дозах может привести к токсичности, которая может привести к серьезным осложнениям. Чрезмерно высокая доза будет более 50 000 МЕ или когда уровень витамина D в крови превышает 150 нг / мл.

Случаи токсичности витамина D обычно связаны с неправильным дозированием. Чтобы предотвратить проблемы, человек должен попросить своего врача проверить уровень витамина D и предложить подходящую дозировку.

Прием витамина D с пищей, содержащей жир, улучшит усвоение этого витамина.

Витамины группы В необходимы для обмена веществ и работы нервной системы.

Комплекс витаминов группы В помогает регулировать обмен веществ и поддерживать центральную нервную систему.

Многие веб-сайты и влиятельные лица в сфере красоты также утверждают, что популярные витамины группы B, такие как B12, могут укреплять и кондиционировать волосы.В следующих разделах мы рассмотрим, что говорится в исследовании.

Комплекс витаминов группы В

Исследователи изучили связь между витаминами группы В и выпадением волос, но они еще не подтвердили связь.

Комплекс витаминов группы B:

  • B1, или тиамин
  • B2, или рибофлавин
  • B3, или ниацин
  • B5, или пантотеновая кислота
  • B6, или пиридоксин
  • B7, или биотин
  • B9, или фолиевая кислота
  • B12, или кобаламин

Лучше всего получать витамины с пищей.Некоторые пищевые источники витаминов комплекса B включают:

  • цельнозерновые
  • овощи, включая темную листовую зелень
  • мясо, например говяжью печень и птицу
  • рыба
  • цельные яйца
  • фасоль и бобовые
  • орехи
  • авокадо

Витамины группы B водорастворимы, а это означает, что организм не может их хранить. Организм выводит с мочой все, что не использует. Вот почему люди должны ежедневно потреблять водорастворимые витамины.

Хотя пищевые источники являются лучшими, многим людям может потребоваться добавка комплекса B для удовлетворения их потребностей.

Факторы, которые могут сделать добавки необходимыми, включают:

  • пожилой возраст
  • наличие состояний, влияющих на пищеварительную систему
  • соблюдение растительной диеты
  • беременность
  • использование определенных лекарств

Люди с любым из этих факторов подвержены более высокому риску развития дефицита определенных витаминов группы В.

Витамин B12

Некоторые источники предполагают, что витамин B12 может играть роль в здоровье волос. Однако несколько исследований, упомянутых в обзоре 2019 года, не обнаружили никаких доказательств связи между изменениями уровня B12 и выпадением или сохранением волос.

Хотя дефицит B12 может привести к выпадению волос, исследования не показывают, что люди, у которых нет дефицита, могут улучшить рост волос с помощью добавки.

Тем не менее, получение достаточного количества витамина B12 необходимо для общего состояния здоровья.Хорошие источники витамина B12 включают мясо, молочные продукты и другие продукты животного происхождения. Также доступны добавки.

Симптомы дефицита B12 включают анемию и утомляемость.

Управление профилактики заболеваний и укрепления здоровья рекомендует взрослым получать 2,4 мкг витамина B12 в день. Беременным нужно 2,6 мкг в день, а людям, кормящим грудью, - 2,8 мкг в день.

Перед употреблением добавок обязательно проконсультируйтесь с врачом, так как некоторые из них могут влиять на действие лекарств.

Витамин B7

Низкий уровень витамина B7 или биотина может привести к выпадению волос.

Исследование, проведенное в 2016 году с участием 541 женщины, выявило дефицит биотина у 38% участниц, страдавших от выпадения волос.

Хотя исследования показали, что дополнительный биотин может быть полезен для роста волос у людей с дефицитом этого витамина, недостаточно доказательств в поддержку использования биотиновых добавок для роста волос у людей со здоровым уровнем биотина.

Комплекс витаминов B можно приобрести в Интернете.

Ученые провели несколько исследований витамина Е и токотриенола. Витамин Е - это питательное вещество, которое действует в организме как мощный антиоксидант.

Исследование, проведенное в 2013 году, показало, что у людей с очаговой алопецией концентрация витамина Е в крови значительно ниже, чем у людей без этого заболевания. Однако, согласно обзору 2019 года, не все исследования подтверждают эти выводы.

Результаты клинического исследования 2010 года также показали, что употребление добавок токотриенола улучшает здоровье волос у людей с алопецией.Эти добавки также помогли предотвратить выпадение волос.

Человек может включить витамин Е в свой рацион, употребляя в пищу зародыши пшеницы, шпинат, рыбу и миндаль.

Некоторые люди предпочитают втирать масло витамина Е непосредственно в кожу или кожу головы, полагая, что это ускорит регенерацию клеток. Однако научные данные еще не подтверждают это.

Витамин Е также доступен в аптеках и в Интернете в форме капсул и жидкости.

Однако стоит отметить, что чрезмерное употребление жирорастворимого витамина Е может вызвать выпадение волос, а также другие побочные эффекты.

Было проведено мало исследований воздействия витаминов D, B и E на волосы, и еще меньше изучали преимущества других незаменимых витаминов для роста волос.

В приведенном ниже списке рассматриваются некоторые другие важные витамины и их влияние на волосы:

  • Мультивитамины: Мультивитамины могут дополнять пищевые источники всех основных витаминов. Получение достаточного количества витаминов улучшит общее состояние здоровья, а также может помочь защитить волосы.Мультивитамины можно приобрести в Интернете.
  • Витамин C: Симптом дефицита витамина C - штопорчатые волоски. Это говорит о том, что витамин С может помочь сохранить здоровье волос, несмотря на отсутствие доказательств того, что он может предотвратить выпадение волос. Красный перец, листовые зеленые овощи и цитрусовые содержат витамин С. Однако добавки можно купить в Интернете.
  • Витамин A: Витамин A, также известный как ретинол, способствует здоровью волос. Он поддерживает секрецию кожного сала - вещества, предотвращающего ломкость волос.Добавки витамина А можно купить в Интернете. Однако некоторые исследования показали, что прием слишком большого количества витамина А может привести к выпадению волос.

Поддержание баланса питательных веществ в рационе и восполнение известного дефицита питательных веществ - лучшие способы поддержать здоровье волос.

Витамины и другие питательные вещества важны для здоровья волос, но некоторые стратегии домашнего ухода также могут помочь.

Например, исследование 2017 года обнаружило доказательства того, что стресс может приводить к выпадению волос.

Чтобы сохранить и улучшить здоровье волос, люди могут:

  • Сократить использование гелей для волос, сушить волосы феном и расчесывать влажные волосы.
  • Уменьшите стресс, выполняя как минимум 150 минут умеренных или интенсивных упражнений в неделю.
  • Выпивайте от шести до восьми стаканов воды в день.
  • Соблюдайте здоровую и богатую питательными веществами диету.

Правильное питание, безопасность продуктов для волос и уровень стресса могут помочь улучшить прочность и внешний вид волос.

Также важно отметить, что постоянное вытягивание волос назад или использование определенных методов укладки волос может усугубить алопецию.

Некоторые добавки и гели для местного применения могут помочь остановить или замедлить выпадение волос. Большинство этих продуктов, включая рогейн, содержат активный ингредиент миноксидил. Кортикостероиды также являются обычными ингредиентами.

Хотя обзор 2019 года показал, что эти продукты могут быть полезны для лечения выпадения волос, существует мало доказательств того, что волосы будут продолжать расти после того, как человек перестанет использовать продукт.

Также стоит отметить, что в большинстве клинических испытаний эффективности средств для роста волос, таких как Rogaine и финастерид (Propecia), участвовали мужчины.

Лучше всего получать питательные вещества из цельных продуктов. Хотя многие витаминные и минеральные добавки могут быть полезны для определенных групп населения, важно приобретать эти продукты у уважаемых компаний, которые проверяют свои продукты на качество и чистоту независимыми третьими сторонами.

Всегда лучше проконсультироваться с врачом, прежде чем принимать пищевую добавку, чтобы убедиться в необходимости и безопасности.

Ряд продуктов доступен для покупки в Интернете, но нет достаточных доказательств того, что они будут работать для всех. Люди должны соблюдать инструкции на упаковке.

Нездоровые волосы могут выглядеть тусклыми и ломкими, а не гибкими и блестящими. Волосы, которые начинают выпадать участками или обламываются кусками, могут быть признаком основного состояния здоровья.

Псориаз, дерматит и рак кожи могут привести к выпадению волос. Другие причины включают облысение по мужскому и женскому типу, очаговую алопецию, стресс и некоторые виды лечения.

Гормональные и генетические факторы играют ключевую роль в росте волос, и вряд ли отдельные витамины будут иметь большее влияние, чем они. Однако они могут помочь тем, кто находится в группе повышенного риска, предотвратить дополнительные проблемы из-за дефицита питательных веществ.

Регулярная стрижка волос помогает сохранить их здоровый вид за счет удаления секущихся кончиков и облегчения веса волос. Это может уменьшить воздействие на корни, которые растут из кожи головы. Здоровая кожа головы - залог здорового роста волос.

Люди, обеспокоенные выпадением волос, могут посетить дерматолога, чтобы определить причину любых проблем с ростом волос.Дерматолог также сможет порекомендовать решения.

Мы выбрали связанные элементы, основываясь на качестве продуктов, и перечислили плюсы и минусы каждого, чтобы помочь вам определить, какой из них лучше всего подойдет вам. Мы сотрудничаем с некоторыми компаниями, которые продают эти продукты, что означает, что Healthline UK и наши партнеры могут получать часть доходов, если вы совершите покупку, используя ссылку (ссылки) выше.

Действительно ли биотин от выпадения волос так же хорош, как рекламируется? - Основы здоровья от клиники Кливленда

В течение многих лет дерматологи незаметно прописывали витамин B под названием биотин от выпадения волос, несмотря на отсутствие исследований, показывающих его пользу.

Клиника Кливленда - некоммерческий академический медицинский центр. Реклама на нашем сайте помогает поддерживать нашу миссию. Мы не поддерживаем продукты или услуги, не принадлежащие Cleveland Clinic. Политика

Почему? Потому что это работает.

«Мы считаем, что биотин очень полезен при заболеваниях волос», - говорит дерматолог Вильма Бергфельд, доктор медицины. «Он также делает ногти толще, а биотин для приема внутрь чрезвычайно безопасен даже в больших дозах».

В основном он используется для обозначения алопеции, медицинского термина, обозначающего облысение у мужчин и женщин.«Биотин улучшает рост волос и помогает при воспалениях», - говорит она. «Волосяной фолликул, кожа и ногти приносят пользу».

Почему выпадают волосы

Выпадение волос имеет несколько причин, многие из которых являются системными. «Если у вас волосы выпадают с корнем, часто что-то не так ваше тело или ваша жизненная ситуация », - говорит д-р Бергфельд.

С выпадением волос связаны определенные заболевания. Среди них эндокринные расстройства, в том числе проблемы с гипофизом, паращитовидные железы или надпочечники, яичники или яички."Например, Женщины в период менопаузы, у которых наблюдается чрезмерное кровотечение, могут терять железо, что вызывает анемию. выпадение волос », - поясняет доктор Бергфельд.

Все, что нарушает работу желудочно-кишечного тракта, также может повлиять на волосы. рост, добавляет она.

Но одна из самых частых причин может вас удивить: питание. «Когда мы смотрим на то, что едят наши пациенты, мы обнаруживаем, что у них часто мало белка и необходимых витаминов», - говорит она. «Кроме того, вам нужно немного углеводов для выработки гормонов, а вашему мозгу нужен жир».

Важно понимать, что вызывает выпадение волос, но это может потребовать некоторой детективной работы.Доктор Бергфельд говорит, что дерматологи начинают с тщательный медицинский осмотр. Затем они просматривают вашу личную историю болезни и ваша семейная история. Они учитывают не только вашу диету, но и ваши привычки к упражнениям. также. Затем они пересматривают ваши лекарства (потому что некоторые из них могут вызвать выпадение волос). и кровь.

Сколько биотина можно принимать при выпадении волос?

Биотин присутствует во многих продуктах питания, включая яйца, рыбу, мясо, семена, орехи, сладкий картофель, брокколи и цветную капусту.

В качестве добавок дерматологи Cleveland Clinic предпочитают Комбинация мега-B витаминов, которая включает:

  • 3 миллиграмма биотина.
  • 30 миллиграммов цинка.
  • 200 миллиграммов витамина С.
  • <1 миллиграмма фолиевой кислоты.

«Иногда мега-комбинация витаминов B дает некоторую у пациентов незначительные проблемы с желудком, но переход на один только биотин облегчает это », - отмечает доктор Бергфельд.

И если вы не можете найти мега-комбинацию витаминов B, вы По ее словам, можно отдельно покупать биотин, цинк и витамин С.

Лучшие витамины для роста волос


Из всех неприятных проблем, связанных с волосами, в мире преждевременное выпадение и выпадение волос являются наихудшими.Это показатель того, что ваша грива далека от здоровья, что ее густота и рост волос нуждаются в быстрой помощи, а ваша кожа головы и волосы испытывают дефицит питательных веществ! Если вы смотрите на рост волос как на цель противодействия этому или даже как на поддержание здорового уровня толщины волос, первым делом убедитесь, что вы получаете правильное питание для своих волос - как местно, так и иным образом. ! Для этого важно употреблять ряд витаминов best для роста волос , которые могут помочь в создании густых, блестящих и здоровых локонов, а также облегчить проблемы с кожей головы и волосами, которые замедляют рост волос.Итак, какие витамины вам следует включить в свой рацион и нанести на волосы? Давайте узнаем, почему и как витамины помогают в росте волос .


1. Витамин A способствует росту волос, обеспечивая увлажнение и питание волос
2. Включайте витамин B в волосы
3. Продукты, богатые витамином C, повышают содержание коллагена в волосах и обеспечивают рост волос
4. Витамин D улучшает здоровье фолликулов и поддерживает рост волос
5. Витамин Е обладает антиоксидантными свойствами, а также смягчающими свойствами, которые делают его идеальным для роста волос
6.Попробуйте эти богатые витаминами маски для волос для хорошего здоровья
7. Часто задаваемые вопросы: Лучшие витамины для волос

Витамин А помогает росту волос, обеспечивая увлажнение и питание волосам


Если вы посмотрите на множество безрецептурных продуктов или добавок для роста волос, они, скорее всего, содержат витамин А, который увеличивает толщину волос . Во-первых, витамин А способствует здоровью клеток и улучшает их функции. Это распространяется на клеточную структуру волос и кожи головы, которая контролируется с помощью витамина А.Когда вы едите или используете витамин А в качестве аппликации, он также естественным образом производит кожный жир, который помогает увлажнять кожу головы и поддерживать ее здоровье на оптимальном уровне. Однако избыток витамина А также может иметь неприятные последствия, поэтому будьте осторожны при его потреблении и ешьте в умеренных количествах.

Что есть: Чтобы получить достаточное количество этого волшебного витамина в своем рационе, вы должны есть продукты, богатые бета-каротином, который превращается в витамин А. Морковь является очевидной необходимостью, как и сладкий картофель , красный сладкий перец, зеленые овощи, такие как капуста и шпинат, вареные яйца, некоторые виды сыра (фета, камамбер, рокфор и чеддер) и масло печени трески.Фрукты, такие как манго, грейпфрут, арбуз, папайя, мандарины и гуава, также богаты витамином А.

Как использовать местно: Хотя большинство продуктов, богатых витамином А, лучше употреблять, чем наносить непосредственно на волосы или кожу головы, вы можете используйте продукт, насыщенный витамином А, согласно инструкции - шампуни, кондиционеры, сыворотки и маски для волос - все это возможно. Они сохраняют волосы увлажненными и питательными, а ускоряют рост волос .

Совет для профессионалов: Придерживайтесь диеты с продуктами, богатыми бета-каротином и витамином А, и применяйте продукты с этим витамином местно, чтобы ускорить рост волос.

Добавьте витамин B в волосы


Из всех витаминов для улучшения состояния волос , витамины группы В являются, пожалуй, наиболее сильнодействующими. Витамины группы B, пожалуй, самые важные для здоровья волос и кожи! Витамины B1 (тиамин), B2 (рибофлавин) и B5 (пантотеновая кислота) хороши для гибкости, силы и общего состояния волос. Фактически, витамин B5 полезен и для надпочечников, что является одним из ключевых факторов эффективного роста волос . Биотин или витамин B7 особенно важны для роста волос .Он признан и используется во всем мире как средство от выпадения волос . Продукты, богатые различными видами витаминов группы B, помогают переносить кислород к коже головы, улучшая кровообращение, тем самым стимулируя здоровье фолликула, обеспечивая его питательными веществами.

Что есть: Чтобы получить суточную дозу витаминов группы В, ешьте не менее двух яиц в день и не упускайте из виду желток - вот где содержится больше половины всей пищи! Они являются лучшим источником этих витаминов, необходимых для роста волос ! Другие источники витамина B включают различную свежую рыбу, такую ​​как форель и лосось, листовая зелень, овсянка, печень животных, йогурт, молоко, бобовые, чечевица и курица и индейка, выращенные на свободном выгуле.

Как использовать местно: Яичная маска, пожалуй, одно из самых эффективных средств для здорового роста волос . Вы также можете использовать ополаскиватель для пива раз в неделю. Витамины группы В, содержащиеся в пиве, укрепляют каждую прядь и укрепляют ее. Кроме того, белок, содержащийся в солоде и хмеле, в максимальной степени восстанавливает поврежденные волосы. Ваши волосы выглядят блестящими, гладкими и теряют вьющиеся, потому что питательные вещества сжимают кутикулу.

Профессиональный совет: Употребляйте продукты, богатые различными витаминами группы B, а также используйте яйца и пиво местно на волосах и коже головы, чтобы ускорить рост волос .

Продукты, богатые витамином С, повышают содержание коллагена в волосах и обеспечивают рост волос


Витамин C
- один из основных источников питания вашего тела, а также волос. Этот драгоценный витамин, пожалуй, единственный, который организм не вырабатывает сам по себе, и поэтому его необходимо потреблять, чтобы уменьшить количество свободных радикалов и поддерживать уровень коллагена в волосяных фолликулах, чтобы волосы оставались без ломкости, а рост волос замедлялся. не пострадали. Он также защищает клетки кожи головы.

Что есть: Как использовать местно: Цитрусовые - самый богатый источник витамина С. Съешьте их в больших количествах, например апельсины, грейпфрут, лайм, гуаву, клубнику и киви. Некоторые овощи, такие как брюссельская капуста и брокколи, также содержат витамин С, который способствует росту волос.

Скромная амала или индийский крыжовник - чудо-фрукт, который часто добавляют в средства для волос, тоники для волос и лечебные средства.Витамин С в амале ускоряет регенерацию клеток, стимулирует как длину, так и объем волос , способствует общему росту волос. Amala содержит более 80 процентов влаги и поэтому обладает увлажняющими свойствами. Это также натуральное очищающее средство для кожи головы. Просто измельчите 3-4 амалы в миске и нанесите мякоть с соком на волосы и кожу головы для оптимального эффекта.

Профессиональный совет: Придерживайтесь диеты, богатой цитрусовыми, чтобы повысить уровень витамина С в организме для роста волос, и регулярно наносите маску для волос амала.

Витамин D улучшает здоровье фолликулов и поддерживает рост волос


Алопеция или выпадение волос - хроническое заболевание, вызванное дефицитом витамина D . Это связано с тем, что витамин D необходим для стимуляции волосяного фолликула и обеспечения его здоровья. Если в вашем организме достаточно витамина D, он поддерживает функцию роста волос.

Что есть: Продукты, богатые витамином D, включают грибы и жирную рыбу, такую ​​как палтус, скумбрия и лосось, а также молоко и молочные продукты.

Как использовать местно: Лучший способ получить суточную дозу - это находиться на солнце не менее 10-15 минут каждый день. Существуют также сыворотки для волос с повышенным содержанием витамина D, которые можно наносить местно на ночь для получения дополнительных преимуществ.

Профессиональный совет: Чтобы убедиться, что витамин D приносит пользу для роста волос, ежедневно проводите 15 минут под прямыми солнечными лучами и придерживайтесь диеты, богатой молоком, грибами и жирной рыбой.

Витамин Е обладает антиоксидантными свойствами, а также смягчающими свойствами, которые делают его идеальным для роста волос


Витамин Е защищает волосы, не позволяя свободным радикалам в окружающей среде ухудшать качество и силу волос.Он способствует росту волос благодаря своим естественным антиоксидантным свойствам, предотвращая разрушение текстуры кожи головы и волос. Это естественный продукт, содержащийся в различных продуктах питания, поэтому, если вы соблюдаете здоровую диету, скорее всего, у вас уже есть витамин E в той или иной форме. Большинство продуктов, богатых витамином E, также содержат полезные жиры, поэтому вы, вероятно, снабдите кожу головы дополнительными смягчающими веществами, которые, в свою очередь, будут способствовать росту волос.

Что есть: Чтобы получить суточную норму витамина Е, постарайтесь включить в свой рацион как можно больше полезных жиров.Авокадо - отличный источник, поэтому старайтесь есть хотя бы один авокадо каждое утро. Масло зародышей пшеницы - еще один отличный источник, поэтому принимайте по чайной ложке в день. Орехи, такие как фисташки, миндаль, фундук, кедровые орехи, кешью, пекан, арахис и бразильские орехи, являются обязательными, и вы также можете каждое утро есть ложку семян - семечек подсолнечника, льняных семян или семян тыквы - для повышения уровня витамина Е потребление. Лосось, форель, лобстер и икра - вот некоторые варианты морепродуктов, а фрукты включают ежевику, клюкву, черную смородину, абрикосы и малину.Выбирайте небольшую порцию овощей, таких как мускатная тыква, спаржа, брокколи и капуста, которые богаты витамином Е.

Как использовать местно: Самый простой и самый эффективный способ нанести витамин Е на волосы и кожу головы - это используйте теплое масло, содержащее этот витамин. Масло арганы , масло сладкого миндаля и касторовое масло являются вариантами. Кокосовое масло содержит относительно меньшее количество, но его также можно использовать.

Совет для профессионалов: Еда. Чтобы узнать больше о том, как витамины способствуют росту волос, посмотрите это видео. Продукты, богатые витамином Е, и нанесение масла, содержащего витамин Е, могут ускорить рост волос


Попробуйте эти богатые витаминами маски для волос для хорошего здоровья

Маска для волос Яйцо-Миндальное масло-Лимонный сок


Ингредиенты

1 яйцо среднего размера Сок из ½ лимона Метод Взбейте яйцо в миске, пока оно не станет пушистым.Добавьте миндальное масло и хорошо перемешайте, пока не получите однородную пасту. Затем добавьте лимонный сок и снова перемешайте. Нанесите его на все волосы, следя за тем, чтобы покрытие было от кожи головы до кончиков прядей. Оставьте это и наденьте шапочку для душа, чтобы запечатать питательные вещества. Через полчаса хорошо промойте шампунем, богатым биотином. Эта маска для волос полезна для борьбы с выпадением волос, увеличения общей толщины, прочности и текстуры волос. Для достижения наилучших результатов используйте этот пакет дважды или трижды в неделю.
2 столовые ложки арганового масла

Скраб для волос с миндально-касторовым маслом

Ингредиенты
10 цельных миндальных орехов Метод
3 столовые ложки касторового масла


Измельчите миндаль с кожурой до получения мелкого порошка.Вы также можете использовать муку, если у вас нет возможности сделать это дома. Добавьте касторовое масло, пока не получите скраб однородной консистенции. Принимайте понемногу и хорошо массируйте кожу головы, стараясь покрыть каждый дюйм поверхности и корни волос. С помощью мягкого массажа вы улучшите кровообращение под кожей головы, а также отшелушите шелушащуюся и сухую кожу головы. Оставьте скраб на 10-15 минут, а затем смойте обычным шампунем. Используйте это один раз в неделю для достижения наилучших результатов.

Часто задаваемые вопросы: Лучшие витамины для волос

Как ускорить рост послеродовых волос, если на баланс влияет дефицит витаминов?


Часто процесс беременности и родов может вызвать физические изменения в вашем теле, которые затем пагубно сказываются на ваших волосах. Это более обычное явление после родов, чем во время беременности. Основная причина заключается в том, что уровень эстрогена, который повысился во время беременности и является причиной густых волос на протяжении этих девяти месяцев, внезапно падает после родов.Это в сочетании с дефицитом витаминов может привести к послеродовому выпадению волос. Решите эту проблему, посетив своего гинеколога или трихолога, который, скорее всего, даст вам богатую витаминами диету и витаминные добавки для борьбы с этим, а также предложит определенные изменения в образе жизни и изменения в том, какие продукты вы используете.

Какие питательные вещества, кроме витаминов, мне нужны для эффективного роста волос?


Селен - это микроэлемент, защищающий ткани кожи головы от окисления.Недостаток равняется небольшому росту волос! Он содержится в грибах, семенах подсолнечника, бразильских орехах, коричневом рисе , цельнозерновой ржи и крабах. Организму также требуется не менее 18 мг железа в день для обеспечения здорового роста и силы волос. Его можно найти в таких продуктах, как тофу, зелень (да, они действительно важны для волос!) И льняное семя. Кремнезем важен для усвоения потребляемых вами витаминов. Продукты, богатые кремнеземом, включают ростки фасоли, огурцы и красный перец. Цинк жизненно важен для баланса ваших гормонов, а также для производства РНК и ДНК, что, в свою очередь, влияет на рост и толщину волос.Прекрасным источником цинка являются устрицы, креветки, мидии, говядина. Омега-3 жирные кислоты необходимы для предотвращения высыхания кожи головы и волосяных фолликулов, уменьшения воспаления (которое является основной причиной выпадения волос) и стимулирования роста волос. Попробуйте лосось - это один из лучших источников. Другая рыба, такая как скумбрия и сардины, также является отличным вариантом. Вегетарианцы могут получать суточную дозу омега-3 из авокадо, оливкового масла и грецких орехов, которые являются одними из самых мощных источников этого питательного вещества.

Могу ли я выбрать безрецептурные витаминные добавки для роста волос?


Добавки, отпускаемые без рецепта, могут помочь вам в вашем стремлении к росту волос, но их не зря называют добавками. Так что не думайте, что вы можете отказаться от правильного ухода за волосами и правильного питания и просто принять таблетку. Скорее, все нужно делать вместе. Добавки, такие как биотин, витамин D и витамин A, широко распространены и могут использоваться для улучшения здоровья волос, но принимать только одобренные FDA препараты, и это тоже только по рецепту.

Подпишитесь на наш канал на YouTube

Какой витаминный дефицит вызывает выпадение волос?

Существует множество распространенных мифов и неправильных терминов о том, почему у кого-то начинают выпадать волосы на голове. Хотя многие слухи ложны, есть несколько вещей, которые наверняка могут повлиять на растущие волосяные фолликулы. Выпадение волос вызывает даже дефицит витаминов.

В Denver Hair Surgery мы здесь, чтобы установить рекорд.Мало кто знает, что одним из наиболее значительных факторов выпадения волос является дефицит витаминов. Но какие витамины являются источником всего этого? А если бы вы начали получать необходимое количество витаминов каждый день, помогло бы это отрастить ваши волосы?

Читайте дальше, чтобы узнать!

Какой витамин все это вызывает?

Есть один витамин, который необходим вашему организму для продолжения роста волос:

Витамин D.

Без достаточного количества витамина D ваши волосяные фолликулы не стимулируются в достаточной степени для роста новых волос.В конце концов, рост ваших волос замедлится, пока вы не начнете давать своему организму полную дозу витамина D. Согласно исследованию, проведенному Dermatol Online, витамин D является важным витамином, необходимым для продолжения роста новых здоровых волос.

Другие факторы риска

Дефицит витаминов вызывает выпадение волос, да. Но выпадение волос - не единственное, чему может способствовать недостаток витамина D. Фактически, Британский журнал дерматологии сообщает, что недостаток витамина D также может сделать вас предрасположенным к алопеции, заболеванию, вызывающему появление залысин по всему телу.Как аутоиммунное заболевание, если его не лечить, алопеция может привести к полному выпадению волос, а также к другим симптомам, которые ставят под угрозу иммунную систему.

К счастью, есть много способов легко избавиться от риска выпадения волос. Витамин D доступен во множестве различных форм и добавок, которые вы можете ввести в свой распорядок дня, чтобы сформировать более здоровые привычки.

Благодарит вас не только волосы, но и вся ваша иммунная система!

Восстановление после риска выпадения волос

Если ваш врач прописывает вам огромную дозу витамина D, есть много способов выполнить этот рецепт.Вы можете принимать добавки или поливитамины, которые добавят в ваш организм изрядное количество витамина D. Но этого все еще недостаточно, чтобы помочь волосяным фолликулам восстановить всю свою силу.

Витамин D содержится во многих продуктах, которые мы едим каждый день. Если вы еще этого не сделали, попробуйте добавить в свой рацион следующие продукты:

  • Жирная рыба, особенно лосось и тунец
  • Сыр
  • Печень
  • Яичные желтки
  • Зерновые
  • Соевое молоко
  • Апельсиновый сок

Однако лучший способ получить сильную дозу витамина D - это чаще находиться на солнце.Большинство людей стараются держаться подальше от солнца из-за риска получить солнечный ожог (или, что еще хуже, повредить кожу из-за солнечного света), но держаться подальше от солнца - не лучшее решение, если вы хотите сохранить свое тело здоровым и счастливым.

Вам нужен солнечный свет, чтобы усваивать витамин D в ваше тело, но это не значит, что вам нужно стоять на улице, пока ваша кожа не поджарится, как печеный картофель. Мы рекомендуем совершить 15-20-минутную прогулку на улице в солнечный день, чтобы насладиться теплом солнечных лучей, прежде чем они начнут вас обжигать.Вы даже можете наслаждаться солнцем внутри, стоя у открытого окна.

Отрастите волосы естественным путем!

В Denver Hair Surgery у нас есть много разных методов, чтобы помочь нашим пациентам отрастить волосы. Волосы могут перестать расти по многим причинам, будь то из-за заболевания, плохого состояния здоровья или других повреждений, и наша обязанность - помочь вам найти лучший способ вернуть их обратно.

Чтобы получить дополнительную информацию о лучшем решении для лечения выпадения волос, свяжитесь с нами через Интернет или позвоните нам по телефону (720) 759-2124, чтобы поговорить с дружелюбным представителем.

Аналоги витамина D3 стимулируют рост волос у голых мышей | Эндокринология

Аннотация

Активная форма витамина D 3 может регулировать кератинизацию эпидермиса, индуцируя терминальную дифференцировку; а у мышей, лишенных рецептора витамина D, обнаруживаются дефекты, приводящие к послеродовой алопеции. Эти наблюдения предполагают участие пути витамина D 3 в регуляции роста волос. Мы протестировали способность 1,25 дигидроксивитамина D 3 и его синтетических аналогов стимулировать рост волос у мышей biege / nude / xid (BNX) nu / nu (nude) с врожденной алопецией.Голых мышей лечили различными аналогами витамина D 3 в дозах, которые, как мы ранее обнаружили, являются наивысшими дозами, не вызывающими токсичности (гиперкальциемии). За мышами наблюдали рост волос и оценивали их по определенной шкале. Образцы кожи были взяты для гистологического исследования волосяных фолликулов и для экстракции РНК и белка. Аналоги витамина D 3 резко стимулировали рост волос у мышей nude, хотя исходный 1,25 дигидроксивитамин D 3 не имел никакого эффекта.Рост волос происходил циклически, сопровождался образованием нормальных волосяных фолликулов и повышенной экспрессией определенных кератинов (Ha7, Ha8 и Hb3). Похоже, что аналоги витамина D 3 действуют на кератиноциты, инициируя циклический цикл волосяных фолликулов и стимулируя рост волос у мышей, у которых в противном случае волосы не растут.

В ходе наших исследований противоопухолевых свойств аналогов витамина D 3 мы обычно использовали мышей с тройным иммунодефицитом beige / nude / xid (BNX) nu / nu (nude) для проверки способности этих соединений предотвращать рост опухоли in vivo .Мы заметили, что у голых мышей росли волосы, когда они получали некоторые аналоги витамина D 3 .

У голых мышей есть изменение зародышевой линии гена Whn (недавно названного Foxn1), влияющее как на рост фолликулярных волос, так и на развитие тимуса (1, 2). У этих мышей ген Whn имеет делецию одного нуклеотида, вызывающую мутацию со сдвигом рамки считывания с преждевременным завершением, что приводит к нефункциональному белку. Ген Whn, фактор транскрипции вилки, экспрессируется исключительно в эпителиальных клетках у всех видов позвоночных.Гены Whn человека и мыши имеют 85% идентичности последовательностей (2). Люди с фенотипом обнаженного тела также имеют врожденную алопецию в результате бессмысленной мутации этого гена (3). Необходимо определить транскрипционные мишени Whn, но они включают гены кератина в волосяном фолликуле. Whn необходим для созревания и дифференцировки матричных эпителиальных клеток. Обычно он выражается в луковице фолликула и наружной корневой оболочке стержня волоса во время образования волос; Отсутствие этого генного продукта у мышей nude приводит к неправильному ороговению эпителиальных клеток фолликулов, что приводит к дефектам корневого влагалища, кутикулы и коры головного мозга, что приводит к ослаблению волос (2, 4, 5).Волосы расслаиваются в фолликуле, образуя кожные кисты (4), содержащие ороговевший материал.

Активная форма витамина D 3 является лигандом для рецептора ядерного гормона, рецептора витамина D 3 (VDR). Мыши с нокаутом VDR не могут инициировать новый цикл роста волос, что приводит к послеродовой алопеции (6). Экспрессия VDR в дермальных сосочках в фолликулярных кератиноцитах во время стадий анагена (рост) и катагена (прекращение) цикла волос предполагает роль VDR в прогрессировании цикла волос (7).Кроме того, обработка кератиноцитов тремя аналогами витамина D 3 подавляла пролиферацию и стимулировала дифференцировку (8).

Эти наблюдения побудили нас изучить способность аналогов витамина D 3 стимулировать рост волос у голых мышей с дефектами кератиноцитов. Было разработано большое количество аналогов витамина D 3 , которые обладают большей способностью вызывать дифференцировку и ингибировать пролиферацию, но вызывают меньшую гиперкальциемию, чем физиологически активное соединение 1,25 дигидроксивитамин D 3 [1,25 (OH ) 2 D 3 ] (9).Мы выбрали шесть аналогов витамина D 3 , которые соответствовали этим характеристикам, и исследовали их способность вызывать рост волос у голых мышей (10–15).

Материалы и методы

Мыши

В наших исследованиях использовали

BNX nu / nu мышей-самцов и самок в возрасте 8 недель. Животные содержались в помещении для животных Медицинского центра Сидарс-Синай, и эксперименты проводились в соответствии с установленными правилами.В одной серии экспериментов по три мужчины были распределены в каждую из шести групп, и каждая когорта получала различное соединение витамина D 3 , а седьмая группа состояла из необработанного контроля BNX nu / nu . Кроме того, трем самцам и трем самкам мышей вводили аналог витамина D 3 , EB1089. Все аналоги вводили внутрибрюшинно три раза в неделю в объеме 200 мкл PBS. Для экспериментов по выщипыванию волос выщипывали волосы из нижней части спины мышей C57 BL / 6 и вводили аналоги витамина D 3 , как описано выше.

Витамин D

3 соединений

Соединения витамина D 3 (рис. 1) растворяли в абсолютном этаноле перед определением молярной концентрации, измеренной по УФ-поглощению с использованием их молярного коэффициента экстинкции при 264 нм. Все аналоги хранили в темноте и при -80 ° C в абсолютном этаноле в качестве исходных растворов 10 -3 м3. Последнее разведение было сделано в PBS перед введением мышам. Мышам давали дозы соединений витамина D 3 , которые, как мы ранее обнаружили, не вызывают токсичности, включая гиперкальциемию.Кроме того, во время лечения мы контролировали уровень кальция в сыворотке крови.

Рисунок 1.

Физическая структура витамина D 3 соединений, использованных в этом исследовании.

Рисунок 1.

Физическая структура витамина D 3 соединений, использованных в этом исследовании.

1,25- (ОН)
2 D 3

1α, 25-дигидроксихолекальциферол, физиологически активная форма витамина D 3 , вводили при 0.0625 мкг / мышь; это было сделано Hoffman-LaRoche Inc.

Ro 25-9022

1α, 25- (OH) 2 -16-ен-23-ин-26,27-F6–19-нор-витамин D 3 имеет шесть фторов в боковой цепи, ненасыщенность по C16 и C23, и удаление метиленовой группы C-19. Его вводили в дозе 0,00125 мкг / мышь. Аналог произведен компанией Hoffman-LaRoche Inc.

KH 1060
.

1α, 25- (OH) 2 -20-эпи-22-окса-24,26,27-тришомовитамин D 3 имеет удлинение боковой цепи и замену углерода C 22 на кислород.Он был произведен Leo Pharmaceuticals и вводился в дозе 0,0125 мкг / мышь.

EB1089

1α, 25- (OH) 2 -диен-24,26,27-тригомовитамин D 3 имеет измененную боковую цепь с 26,27 диметильными группами со вставкой дополнительного углерода в C- 24 (24a) и две транс двойные связи при атомах углерода 22,23 и 24,24a. Он был произведен Leo Pharmaceuticals и давался в дозе 0,05 мкг / мышь.

Ro 27-0574

1α, 25 (OH) 2 -23-ен-26,27-гексафтор-19-нор-20-циклопил витамин D 3 содержит шесть фторов в боковой цепи, транс-23,24 двойной связь и циклопропильная группа при C 20 .Он был произведен Hoffman-LaRoche Inc. и давался в дозе 0,005 мкг / мышь.

Ro 27-5646

1α, 25 (OH) 2 - (3-метил-3-гидроксибутил) -19-нор-витамин D 3 имеет две боковые цепи с удалением метиленовой группы C-19 и был задан 0,01 мкг / мышь. Это было сделано Hoffman-LaRoche Inc.

Ro 26-9114

1α, 25 (OH) 2 -16-ен-19-нор-24-оксо-витамин D 3 содержит двойную связь у C-16 и кетогруппу в боковой цепи.Он был синтезирован Hoffman-LaRoche Inc. и вводился в дозе 6 мкг / мышь.

Шкала для мониторинга волос у мышей BNX nu / nu

Мы разработали шкалу для измерения роста волос у мышей BNX (таблица 1).

Таблица 1. Шкала

для мониторинга волос у мышей BNX nu / nu

4
SCORE . ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированные, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
. 4
ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированные, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
Таблица 1.

Шкала для мониторинга волос у мышей BNX nu / nu

4
SCORE . ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированные, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
. 4
ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
Кожа толстая, пигментированные, рассеянные волосы
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела

Гистологический анализ волосяных фолликулов

Образцы кожи были получены после обработки либо соединениями витамина D 3 , либо контрольным разбавителем.Их фиксировали для гистологического анализа в 10% нейтральном забуференном формалине, окрашивали гематоксилином / эозином и исследовали под микроскопом.

Анализ РНК

Образцы кожи мышей с максимальной оценкой были обработаны на РНК, преобразованы в кДНК и использованы в ПЦР для проверки экспрессии генов различных кератинов (10). Праймеры для генов кератина представлены в таблице 2.

Таблица 2.

Праймеры для генов кератина

Кератиновый тип волос . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Кератиновый тип волос . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Таблица 2.

Праймеры для генов кератина

Кератиновый тип волос . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Кератиновый тип волос . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG

Анализ белков

Антисыворотки против кератиновых белков использовали для вестерн-блоттинга для установления паттернов экспрессии на уровне белка (16, 17).Одна антисыворотка была против кислого кератина волоса типа I Ha8, который обычно проявляет сложный характер экспрессии в растущих фолликулах; и вторым признанным основным кератином волос типа II Hb3.

Результаты

Голые мыши получали либо соединения витамина D 3 , либо контрольный разбавитель в дозе, которая, как мы ранее обнаружили, ингибировала клональную пролиферацию раковых клеток, но не была связана с гиперкальциемией, которая является основной токсичностью витамина D 3 (Таблица 3 , Рис.1 и ссылки. 10–13). У этих мышей развились волосы, как показано на фиг. 2. Гистологическое исследование подтвердило, что аналоги витамина D 3 стимулировали образование волосяных фолликулов (фиг. 3). Наблюдение под микроскопом образцов кожи с пиком 8 в группах лечения аналогом витамина D 3 показало полностью сформированный волосяной фолликул; напротив, в контрольных образцах не наблюдали волосяного фолликула или только деформированные волосяные фолликулы.

Рисунок 2.

Фотография голых мышей. A. Верхняя мышь получала контроль с разбавителем, а нижняя мышь получала аналог витамина D 3 Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю. B. Мыши получали слева направо : Ro 27-5646 при 0,01 мкг / мышь, контроль с разбавителем и Ro27-0574 при 0,005 мкг / мышь.

Рисунок 2.

Фотография голых мышей. A. Верхняя мышь получала контроль с разбавителем, а мышь нижняя получала аналог витамина D 3 , Ro 25-9022, при 0.00125 мкг / мышь, внутрибрюшинно, три раза в неделю. B. Мыши получали слева направо : Ro 27-5646 при 0,01 мкг / мышь, контроль с разбавителем и Ro27-0574 при 0,005 мкг / мышь.

Рис. 3.

A, Кожа контрольной голой мыши с абортивными волосяными фолликулами и рудиментарными волосяными фолликулами. Подопытная голая мышь (B) обнаружила нормальные волосяные фолликулы, простирающиеся в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю в течение 36 дней (см.рис.2). Срезы окрашивали гематоксилином и эозином (исходное увеличение × 100).

Рис. 3.

A, Кожа контрольной голой мыши с абортивными волосяными фолликулами и рудиментарными волосяными клетками. Подопытная голая мышь (B) обнаружила нормальные волосяные фолликулы, простирающиеся в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю в течение 36 дней (см. Фиг. 2). Срезы окрашивали гематоксилином и эозином (исходное увеличение × 100).

Таблица 3.

Витамин D 3 соединений: сводка их антипролиферативной и кальциемической активности

1,2 (OH)
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0.01 мкг / мышь 10
Ro 27-0574 2 × 10 −10 2 × 10 −9 ND a 14 EB 5 × 10 −11 0,5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / 41 мышь
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
2 D 3 1 × 10 −8 1 × 10 −7 0,0625 мкг / мышь 10, 11, 12, 13, 14, 15
45 - 2 × 10 10
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,01 мкг / мышь 10
Ro 27-0574 2 907 −10 2 × 10 −9 ND a 14
EB 1089 5 × 10 −11 0.5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 11
Ro 25-9022 6 × 10 −10 0,00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,01246 мышь 13
1,25 (OH) 2 D 3 1 × 10 −8 1 × 10 −7 0.0625 мкг / мышь 10, 11, 12, 13, 14, 15
Таблица 3.

Соединения витамина D 3 : сводная информация об их антипролиферативной и кальциемической активности

1,2 (OH)
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0.01 мкг / мышь 10
Ro 27-0574 2 × 10 −10 2 × 10 −9 ND a 14 EB 5 × 10 −11 0,5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / 41 мышь
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
2 D 3 1 × 10 −8 1 × 10 −7 0,0625 мкг / мышь 10, 11, 12, 13, 14, 15
45 - 2 × 10 10
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . MCF-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,01 мкг / мышь 10
Ro 27-0574 2 907 −10 2 × 10 −9 ND a 14
EB 1089 5 × 10 −11 0.5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 11
Ro 25-9022 6 × 10 −10 0,00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,01246 мышь 13
1,25 (OH) 2 D 3 1 × 10 −8 1 × 10 −7 0.0625 мкг / мышь 10, 11, 12, 13, 14, 15

Мы исследовали рост волос голых мышей, когда они получали разбавитель (контрольные мыши), 1,25 (OH) 2 D 3 , или один из пяти аналогов витамина D 3 . Каждая группа состояла из трех мышей. Влияние аналогов витамина D 3 на рост волос голых мышей систематически оценивали для каждой мыши, выставляя им баллы по шкале от 1 до 10 (таблица 1), три раза в неделю. Оценка роста волос учитывает толщину и пигментацию кожи, поскольку это косвенно коррелирует с индукцией анагена, который является фазой роста волосяного цикла.Например, оценка 5 означает утолщение кожи с сильной пигментацией, что отражает формирование стержня волоса до выступа волос над поверхностью кожи. Время до появления волос и количество волос варьировали от мыши к мыши и для аналогов витамина D 3 (фиг. 4).

Рисунок 4.

Влияние витамина D 3 соединений на рост волос у голых мышей. Мышей лечили соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1.Каждая панель показывает репрезентативные эксперименты. Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P <0,05 для самок мышей, представленных в F.

Рисунок 4.

Влияние соединений витамина D 3 на рост волос у мышей nude. Мышей лечили соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1. На каждой панели показаны репрезентативные эксперименты.Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P <0,05 для самок мышей, представленных в F.

Максимальный показатель роста волос был постоянно выше у мышей, получавших аналоги витамина D 3 , чем у контрольных мышей (таблица 4). Соединения KH 1060, Ro 27-5646 и EB1089 были наиболее эффективными при стимуляции роста волос. 1,25 (OH) 2 D 3 мало влияли на рост волос (таблица 4, рис.4). Время достижения максимального роста волос варьировалось в группах лечения витамином D 3 . Например, латентный период составлял в среднем 9 дней для мышей, получавших группы Ro 27-0574 или EB1089 (самки), тогда как он составлял 18 дней для самцов, получавших EB1089, и 21 день для мышей, получавших KH 1060 (рис. ). Быстрая потеря волос довела оценки до исходного уровня в течение 4 дней, даже несмотря на то, что лечение аналогом витамина D 3 не было прекращено. Второй цикл роста волос (пиковая оценка 7-8) произошел в группах лечения Ro 25-9022-, Ro 27-0574- и EB1089 примерно через 19 дней после первого цикла.Мы также исследовали способность EB1089 стимулировать рост волос у самцов и самок мышей. У обоих была стимуляция волос; первый пик роста волос у женщин немного предшествовал пику у мужчин (рис. 4F).

Таблица 4.

Сводная информация о наивысших показателях волосяного покрова, полученных у голых мышей, получавших витамин D 3 аналогов

7 7 7
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
907 907 4 5 7 8 7
3 4 8 6 8 6 4 7 Среднее 00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 907 45 907 907 907 46 1,00 0,58 1,00 0,58 0,58 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
7 7 7
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
907 907 4 5 7 8 7
3 4 8 6 8 6 4 7 Среднее 00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 907 45 907 907 907 46 1,00 0,58 1,00 0,58 0,58 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
Таблица 4.

Сводные данные о наивысших показателях волосяного покрова, достигнутых голыми мышами, получавшими витамин D 3 аналогов

7 7 7
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
907 907 4 5 7 8 7
3 4 8 6 8 6 4 7 Среднее 00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 907 45 907 907 907 46 1,00 0,58 1,00 0,58 0,58 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
7 7 7
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
907 907 4 5 7 8 7
3 4 8 6 8 6 4 7 Среднее 00 4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 907 45 907 907 907 46 1,00 0,58 1,00 0,58 0,58 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01

РНК и белок были экстрагированы из одних и тех же образцов кожи с наивысшей оценкой около 8 у мышей, получавших EB1089 и Ro 25-9022, и у мышей, получавших 1,25 (OH) 2 D 3 или контроль разбавителя. КДНК была сделана и амплифицирована для экспрессии кератиновых генов. Экспрессия мРНК кератина дифференциально регулировалась в коже животных, получавших аналог витамина D 3 (фиг. 5). 1,25 (OH) 2 D 3 увеличивал экспрессию мРНК Ha1, но не влиял на уровни любого другого из исследованных кератинов (рис.5, А и Б). Кожа мышей, получавших EB1089 или Ro 25-9022, показала значительно повышенную экспрессию мРНК ( P <0,05) кератинов Ha1, Ha7, Ha8 и Hb3. Экспрессия На4 значимо не увеличивалась ни при каком лечении. Экспрессию кератинов Hb3 и Ha8 определяли на уровне белка с помощью вестерн-блоттинга (рис. 6). В соответствии с результатами ПЦР уровни Hb3 и Ha8 были увеличены в коже мышей, обработанных Ro 25-9022 и EB 1089, но не обработанных 1,25 (OH) 2 D 3 .

Рисунок 5.

A, Влияние витамина D 3 аналогов на экспрессию мРНК кератина в коже голых мышей. A, RT-PCR анализ РНК, полученной из кожи мышей, обработанных либо контрольным разбавителем, 1,25 (OH) 2 D 3 , либо аналогами витамина D 3 . КДНК с обратной транскрипцией амплифицировали с помощью ПЦР с использованием наборов праймеров, специфичных для кератинов, для 35 циклов или 18S РНК для 25 циклов. В. Цифровое количественное определение сигналов для пяти кератинов, как показано на А.Относительная экспрессия кератина определяется путем нормализации до уровней 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, P <0,05.

Рисунок 5.

A, Влияние витамина D 3 аналогов на экспрессию мРНК кератина в коже голых мышей. A, RT-PCR анализ РНК, полученной из кожи мышей, обработанных либо контрольным разбавителем, 1,25 (OH) 2 D 3 , либо аналогами витамина D 3 .КДНК с обратной транскрипцией амплифицировали с помощью ПЦР с использованием наборов праймеров, специфичных для кератинов, для 35 циклов или 18S РНК для 25 циклов. B. Цифровое количественное определение сигналов для пяти кератинов, как показано на рисунке A. Относительная экспрессия кератина определяется путем нормализации до уровней 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, P <0,05.

Рисунок 6.

Влияние витамина D 3 аналогов на экспрессию белков кератина волос.Вестерн-блот анализировали последовательно с помощью антисывороток против Hb3 и Ha8, а также глицеральдегид-3-фосфатдегидрогеназы (контроль нагрузки).

Рисунок 6.

Влияние витамина D 3 аналогов на экспрессию белков кератина волос. Вестерн-блот анализировали последовательно с помощью антисывороток против Hb3 и Ha8, а также глицеральдегид-3-фосфатдегидрогеназы (контроль нагрузки).

Чтобы выяснить, является ли эффект стимуляции роста волос с помощью аналогов витамина D 3 специфическим для голых мышей, мышам C57 BL / 6 давали либо Ro 25-9022, либо Ro 26-9114 три раза в неделю после возобновления роста волос. стимулировался выщипыванием волос.Оценка волос производилась три раза в неделю с использованием той же шкалы, которая описана в таблице 1. Во время лечения любым из аналогов витамина D 3 не наблюдалось ускорения роста волос (фиг. 7).

Рисунок 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL / 6. Мыши C57 BL / 6 получали контрольный разбавитель Ro 26-9114 или Ro 25-9022 три раза в неделю со дня выщипывания волос.Оценка волос производилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение от восьми мышей.

Рисунок 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL / 6. Мыши C57 BL / 6 получали контрольный разбавитель Ro 26-9114 или Ro 25-9022 три раза в неделю со дня выщипывания волос. Оценка волос производилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение от восьми мышей.

Обсуждение

Волосяные фолликулы непрерывно проходят три фазы (см.18): фаза роста (анаген), стадия инволюции (катаген) и период покоя (телоген). Молекулярные сигналы, которые контролируют переход фолликулов между этими стадиями, до конца не изучены. На рост волос влияют различные гормоны, в том числе эстроген, гормон роста и андрогены (19, 20). Андрогены могут способствовать миниатюризации фолликулов и сокращению продолжительности стадии анагена. Напротив, эстроген может продлить стадию анагена.

Стимуляция роста волос - это так называемый Святой Грааль, к которому стремятся многие ученые, особенно в фармацевтических компаниях.На рынке есть несколько препаратов, стимулирующих рост волос, в том числе миноксидил и финастерид (21, 22). Миноксидил продлевает стадию анагена роста волос и вызывает увеличение и рост фолликулов в состоянии покоя. Он удлиняет и увеличивает небольшие пушковые волоски и уменьшает выпадение волос (21). Как он опосредует эти эффекты, неясно. Финастерид представляет собой ингибитор 5-α редуктазы 2 типа, который снижает уровень дигидротестостерона в сыворотке и коже и, следовательно, ингибирует андроген-зависимую миниатюризацию волосяных фолликулов (22).

Мыши с нокаутом рецептора витамина D характеризуются 1,25 (OH) 2 D 3 -резистентным рахитом с гипокальциемией, гипофосфатемией, гиперпаратиреозом, рахитом, остеомаляцией и алопецией (6, 23, 24). Перевод этих животных на диету с высоким содержанием кальция, фосфора и лактозы может нормализовать их фенотип, за исключением алопеции (23, 25). Кроме того, у людей с устойчивым к витамину D 3 рахит типа 2 имеет инактивирующую зародышевую линию мутацию VDR с частичной или полной алопецией (26).Исследования с использованием мышей с нокаутом VDR показали, что кератиноциты являются аберрантными клетками, ответственными за их фенотип без шерсти (23, 27). Кератиноциты экспрессируют Whn, и анализы восстановления волос показали, что они являются дефектным типом клеток в развитии волос голых мышей (2). Исследования показали, что экспрессия нескольких генов кератина снижена в голой коже и что транскрипция гена кератина может регулироваться Whn (4, 28). В наших исследованиях мы показали, что лечение голых мышей аналогами витамина D 3 увеличивало экспрессию кератинов в их коже одновременно с ростом волос.Эти наблюдения предполагают, что аналоги витамина D 3 действуют временно, нормализуя кератиноциты голых мышей, что позволяет производить волосы.

Выщипывание волос вызывает начало новой фазы анагена волосяного фолликула. Наши эксперименты с использованием мышей C57 BL / 6 показали, что аналоги витамина D 3 не влияли на повторное появление волос после выщипывания. Это наблюдение предполагает, что аналоги витамина D 3 не влияют на индукцию анагена. Аналоги витамина D 3 , по-видимому, действуют ниже Whn, о чем свидетельствует их способность увеличивать экспрессию мРНК генов-мишеней Whn, кератина Ha1, Ha7, Ha8 и Hb3, в коже голых мышей.Ранее было показано, что 1,25 (OH) 2 D 3 активирует экспрессию кератина во время дифференцировки кератиноцитов (29), хотя этот эффект был косвенным (30). В кератиноцитах Whn экспрессируется на ранних стадиях терминальной дифференцировки, где он активирует маркеры ранней дифференцировки, такие как кератин 1 (4, 31). Наши наблюдения на голых мышах показывают, что лечение аналогами витамина D 3 способно преодолеть блокировку дифференцировки кератиноцитов, вызванную инактивацией Whn, что приводит к увеличению экспрессии кератина и образованию видимых волос.

Недавнее исследование продемонстрировало, что у пациента с мутировавшим VDR алопеция была неотличима от атрихии, вызванной мутациями в гене безволосости (32). Авторы пришли к выводу, что VDR и ген безволосости могут быть частью одного и того же или конвергентного генетического пути, необходимого для нормального цикла волос. У голых мышей аберрантный фенотип вызван дефектом катагена (33). Это повышает вероятность того, что аналоги витамина D 3 могут регулировать экспрессию генов, контролирующих катаген.

В наших экспериментах введение 1,25 (ОН) 2 D 3 не вызывало роста волос у мышей nude; однако различные аналоги витамина D 3 действительно вызывали рост волос. Ранее было показано, что все эти аналоги обладают большей способностью вызывать дифференцировку и ингибировать пролиферацию различных типов клеток, связанных с раком, как in vitro, , так и in vivo (10-15) (Таблица 3). Следовательно, вероятная причина, по которой аналоги витамина D 3 способны стимулировать рост волос у голых мышей, тогда как 1,25 (OH) 2 D 3 не могут, заключается в том, что они обладают большей эффективностью in vivo .Каждый из аналогов способен связываться с VDR (9). Некоторые из механизмов, которые, как предполагается, объясняют их повышенную эффективность, включают тот факт, что они уменьшили связывание с D-связывающим белком в сыворотке, что обеспечивает более свободный доступ к проникновению в клетку. Эти аналоги могут изменять конформацию VDR, делая их более активными, или они могут увеличивать период полужизни активированного VDR (34). Они также могут модулировать способность корепрессоров или соактиваторов взаимодействовать с активированным лигандом VDR (35).Каким бы ни был механизм, эти аналоги действуют на волосяной фолликул голых мышей, вероятно, за счет стимуляции экспрессии генов, таких как кератины, которые находятся ниже по течению от дефектного фактора транскрипции Whn; и эти гены имеют решающее значение для формирования стержня волоса (16, 17, 31). Таким образом, наши результаты убедительно доказывают, что аналоги витамина D 3 могут стимулировать рост волос у голых мышей, у которых обычно нет видимых волос.

Благодарности

Эта работа была частично поддержана семейным фондом Сида и Энн Шварц, Horn Trust и Parker Hughes Foundation.H.P.K. является заведующим кафедрой онкологии Марка Гудсона в медицинском центре Cedars Sinai и членом онкологического центра Йонссона.

Сокращения

  • BNX

  • 125 (OH) 2 D 3

  • VDR

1

Nehls

M

,

Pfeifer

D

D

Hedrich

H

,

Boehm

T

1994

Новый член семейства белков winged-helix, разрушенный при мутациях nude у мышей и крыс

.

Nature

372

:

103

-

107

2

Brissette

JL

,

Li

J

,

Kamimura

J

,

Lee

GP

1996

Продукт голого локуса мыши, Whn, регулирует баланс между ростом и дифференцировкой эпителиальных клеток

.

Genes Dev

10

:

2212

-

2221

3

Фрэнк

J

,

Pignata

C

,

Пантелеев

AA

,

H DM

Prowse

,

Weiner

L

,

Gaetaniello

L

,

Ahmad

W

,

Pozzi

N

,

Cserhalmi-Friedman

PB

, Utndman

PB

H

,

Gordon

D

,

Ott

J

,

Brissette

JL

,

Christiano

AM

1999

Выявление фенотипа человеческого обнаженного тела

.

Nature

398

:

473

-

441

4

Schorpp

M

,

Schlake

T

,

Kreamalmeyer

D

000

Allen

000

Allen

2000

Генетически разделимые детерминанты экспрессии гена кератина волос

.

Dev Dyn

218

:

537

-

543

5

Schlake

T

,

Schorpp

M

,

Nehls

M

Boeh Ген nude кодирует специфичный для последовательности ДНК-связывающий белок с гомологами у организмов, у которых отсутствует упреждающая иммунная система

.

Proc Natl Acad Sci USA

94

:

3842

-

3847

6

Yoshizawa

T

,

Handa

Y

,

Uematsu

Y

a,

a

K

,

Yoshihara

Y

,

Kawakami

T

,

Arioka

K

,

Sato

H

,

Uchiyama

000 Ychiyama

000 Ychiyama

A

,

Matsumoto

T

,

Kato

S

1997

У мышей, лишенных рецептора витамина D, после отлучения от груди

наблюдается нарушение костеобразования, гипоплазия матки и задержка роста.

Нат Генет

16

:

391

-

396

7

Райхрат

Дж

,

Шилли

М

,

Кербер

А 9000 ФА3,

Бахмер 9000

,

Paus

R

1994

Экспрессия в волосяных фолликулах 1,25-дигидроксивитмина D 3 рецепторов во время цикла волос мышей

.

Br J Dermatol

131

:

477

-

482

8

Bikle

DD

,

Gee

E

,

Pillai

S 9000ocyte

Регулирование роста и дифференциации 1993 года Метаболизм витамина D аналогами 1,25-дигидроксивитамина D3

.

J Invest Dermatol

101

:

713

-

718

9

Бульон

R

,

Okamura

WH

,

Norman

Функция A

Взаимосвязи между витамином 1995 Эндокринная система D

.

Endocr Ред.

16

:

200

-

257

10

Hisatake

J

,

O'Kelly

J

,

Uskokovic

M

u

,

Kotoy

HP

2001

Новый витамин D 3 аналог, 21- (3-метил-3-гидроксибутил) -19-нор-D 3 , который модулирует рост клеток, дифференцировку, апоптоз, клеточный цикл , и индукция PTEN в лейкозных клетках

.

Кровь

97

:

2427

-

2433

11

Шиохара

M

,

Ускокович

M

,

Хисатаке

J

,

000 Хисатаке ,

Komiyama

A

,

Koeffler

HP

2001

24-оксо метаболиты аналогов витамина D3: устранение их выраженных антилейкемических эффектов из-за отсутствия модуляции кальция

.

Cancer Res

61

:

3361

-

3368

12

Lee

YY

,

Kim

ES

,

Seol

JG

,

BIM

up

Elstner

E

,

Park

DJ

,

Koeffler

HP

1996

Влияние аналога витамина D 3 , EB1089, на гемопоэтические стволовые клетки

миукоидных лейкоцитов.

Лейкемия

10

:

1751

-

1757

13

Elstner

E

,

Linker-Israel

M

,

Said

J

,

Umiel

S

,

Shintaku

IP

,

Heber

D

,

Binderup

L

,

Uskokovic

M

,

Koeffler

HP

3 аналогов: новый класс сильнодействующих ингибиторов пролиферации и индукторов дифференцировки линий клеток рака молочной железы человека

.

Cancer Res

55

:

2822

-

2830

14

Koike

M

,

Koshisuzuka

K

,

Sawabata

H

000

, Янг

,

Said

J

,

Uskokovic

M

,

Tsuruoka

N

,

Koeffler

HP

1999

аналог витамина D8-Cyclopropyl-9055 мощные ингибиторы пролиферации клеточных линий простаты, груди и миелоидного лейкоза человека

.

Anticancer Res

19

:

1689

-

1698

15

Kubota

T

,

Koshizuka

K

,

Koike

M

hi 9000

M

hi

M

,

Koeffler

HP

1998

19-нор-26, 27-бисомовитамин D 3 Аналоги : уникальный класс мощных ингибиторов пролиферации раковых клеток простаты, груди и кроветворных

.

Cancer Res

58

:

3370

-

3375

16

Rogers

MA

,

Winter

H

,

Wolf

C

,

Heck

M

1998

Характеристика домена пар 190 килобаз генов кератина волос типа I человека

.

J Biol Chem

273

:

26683

-

26691

17

Langbein

L

,

Rogers

MA

,

Winter

H

,

Schneider

J

2001

Каталог кератинов человеческого волоса.II. Экспрессия шести членов типа II в волосяном фолликуле и объединенный каталог человеческих кератинов I и II типа

.

J Biol Chem

276

:

35123

-

35132

18

Fuchs

E

,

Merrill

BJ

,

Jamptora

C

,

C

В основе нескончаемого цикла

.

Dev Cell

1

:

13

-

25

19

Sawaya

ME

,

Penneys

NS

1992

Иммуногистохимическое распределение ароматазы фолиевой кислоты и протеодезе 3B сальник

.

J Cutan Pathol

19

:

309

-

314

20

Hodgins

MB

,

Murad

S

1986

25-дигидро-оксидроэстинэстиновый холестерин в коже человека стимулирует превращение 25-дигидро-оксихолестов в кожу человека культура

.

J Эндокринол

110

:

R1

-

R4

21

DuCharme

DW

,

Freyburger

WA

,

Graham

000

000

000 9G

BE

000

BE

000

свойства миноксидила: новое гипотензивное средство

.

J Pharmacol Exp Ther

184

:

662

-

670

22

McClellan

KJ

,

Markham

A

1999

Finasteride анализ облысения при выпадении волос у мужчин. .

Наркотики

57

:

111

-

126

23

Sakai

Y

,

Кишимото

J

,

Demay

MB

2001

клеточный анализ метаболизма

9000 мышей с нокаутом рецепторов

.

J Clin Invest

107

:

961

-

966

24

Li

YC

,

Pirro

AE

,

Amling

M

,

GD

R

,

Bronson

R

,

Demay

MB

1997

Целевое удаление рецептора витамина D: животная модель витамин D-зависимого рахита II типа с алопецией

.

Proc Natl Acad Sci USA

94

:

9831

-

9835

25

Li

YC

,

Amling

M

,

Pirro

AE

000 M

000 M

J

,

Baron

R

,

Delling

G

,

Demay

MB

1998

Нормализация гомеостаза минеральных ионов диетическими средствами предотвращает гиперпаралопеидизм, ахиторию и рак Мыши с удаленными рецепторами витамина D

.

Эндокринология

139

:

4391

-

4396

26

Hewison

M

,

O’Riordan

JLH

1994

Устойчивость к витамину D

.

Baillieres Clin Endocrinol Metab

9

:

305

-

315

27

Chen

CH

,

Sakai

Y

,

Demay

MB

2001

экспрессия человека Рецептор D кератиноцитов мышей с нулевым рецептором витамина D предотвращает алопецию

.

Эндокринология

142

:

5386

-

5392

28

Schlake

T

,

Schorpp

M

,

Maul-Pavicic

000

000 AM

000

000

000

000 AM

000

000

000 AM

000

000 T

2000

Фактор транскрипции «вилка / крылатая спираль» Whn регулирует экспрессию гена кератина волос: молекулярный анализ фенотипа «голой» кожи

.

Dev Dyn

217

:

368

376

29

Hosomi

J

,

Hosoi

J

,

Abe

E

,

000 T

000

Suda

000 T

1983

Регуляция терминальной дифференцировки культивируемых эпидермальных клеток мыши с помощью 1,25-дигидроксивитамина D3

.

Эндокринология

113

:

1950

-

1957

30

Блюменберг

M

,

Коннолли

DM

,

Freedberg

IW

Регулирование экспрессии гена IW

Роль рецепторов ядерных гормонов ретиноевой кислоты, гормона щитовидной железы и витамина D3

.

J Invest Dermatol

98

:

42

S – 49S31

Baxter

RM

,

Brissette

JL

2002

Роль голого гена в терминальной дифференцировке эпителия

.

J Invest Dermatol

118

:

303

-

309

32

Миллер

J

,

Джабали

K

,

Чен

Т

000

000 Liu

000

Liu

M

,

Lyle

S

,

Christiano

AM

,

Holick

M

,

Cotsarelis

G

2001

Атрихия, вызванная мутациями в гене генерализованного фенокартона D atrichia, вызванные мутациями в гене бесшерстности

.

J Invest Dermatol

117

:

612

-

617

33

Пантелеев

AA

,

Бочкарева

NV

,

Sundberg

JP

,

Paus R

1999

Роль гена безволосого (hr) в регуляции катагенной трансформации волосяного фолликула

.

Am J Pathol

155

:

159

-

171

34

Van den Bemd

GC

,

Pols

HA

,

Birkenhager

en JC

,

,

1996

Изменение конформации и усиленная стабилизация рецептора витамина D с помощью аналога 1,25-дигидроксивитамина D3 KH 1060

.

Proc Natl Acad Sci USA

93

:

10685

-

10690

35

Campbell

MJ

,

Koeffler

HP

1997

На пути к терапевтическому вмешательству в лечение рака D.

J Национальное онкологическое учреждение

89

:

182

-

186

Авторские права © 2002, Общество эндокринологов

(PDF) Роль витаминов и минералов в выпадении волос: обзор

35.Дурусой С., Озенли Ю., Адигузель А. и др. Роль

психологических факторов и уровней сывороточного цинка, фолиевой кислоты и

витамина B12 в этиологии триходинии: исследование

случай-контроль. Clin Exp Dermatol.

2009; 34 (7): 789–92.

36. Zempleni J, Hassan YI, Wijeratne SS. Биотин и дефицит

биотинидазы. Expert Rev Endocrinol

Metab. 2008. 3 (6): 715–24.

37. Боккалетти В., Зендри Э., Джордано Дж., Гнетти Л., Де

Панфилис Г.Семейный синдром нерасчесываемых волос:

ультраструктурное исследование волос и реакция на биотин.

Pediatr Dermatol. 2007; 24 (3): E14–6.

38. Шелли В.Б., Шелли Э.Д. Синдром нерасчесываемых волос

: наблюдения за ответом на биотин и встречаемость

у братьев и сестер с эктодермальной дисплазией.

J Am Acad Dermatol. 1985. 13 (1): 97–102.

39. Trueb RM. Уровни биотина в сыворотке крови у женщин составляют

от выпадения волос. Int J Trichol. 2016; 8 (2): 73–7.

40. Даулатабад Д., Сингал А., Гровер С., Чиллар Н.

Проспективное аналитическое контролируемое исследование, оценивающее

сывороточного биотина, витамина b12 и фолиевой кислоты у пациентов

с преждевременным посасанием. Int J Trichol.

2017; 9 (1): 19–24.

41. Кармель Р. Фолиевая кислота. В: Shils M, Shike M, Ross A,

Caballero B, Cousins ​​R, редакторы. Современное питание в

здоровье и болезни. Балтимор: Липпинкотт Уильямс

и Уилкинс; 2005 г.п. 470–81.

42. Bailey RL, Dodd KW, Gahche JJ, et al. Общее потребление фолиевой кислоты

и фолиевой кислоты с продуктами питания и диетическими добавками в США: 2003–2006 гг. Am J

Clin Nutr. 2010. 91 (1): 231–7.

43. Harvard TH, Chan School of Public Health. Три из

витаминов группы В: фолиевая кислота, витамин B6 и витамин B12.

Бостон, Массачусетс: Гарвард T.H. Государственная школа Чан

Здравоохранение; 2018. По состоянию на 8 августа 2018 г.

44.Gonul M, Cakmak SK, Soylu S, Kilic A, Gul U. Сыворотка

Уровни витамина B12, фолиевой кислоты, ферритина и железа у

турецких пациентов с очаговой алопецией. Индийский J

Дерматол Венереол Лепрол. 2009; 75 (5): 552.

45. Эртугрул Д.Т., Карадаг А.С., Такчи З. и др. Сыворотка

уровней холотранскобаламина, витамина B12, фолиевой кислоты и

гомоцистеина у пациентов с очаговой алопецией.

Cutan Ocul Toxicol. 2013; 32 (1): 1–3.

46. Юсеф М., Намази М.Р., Рахими Х., Юнеспур С.,

Эхсани А.Х., Шакой С.Оценка сывороточного гомо-

цистеина, высокочувствительного СРБ и фолиевой кислоты в эритроцитах у

пациентов с очаговой алопецией. Индийский J Dermatol.

2014; 59 (6): 630.

47. Калкан Г., Йигит С., Каракус Н. и др. Метилент-

трагидрофолатредуктаза мутация C677T у

пациентов с очаговой алопецией в турецком населении.

Ген. 2013. 530 (1): 109–12.

48. Cheung EJ, Sink JR, English Iii JC. Недостаток витаминов и

минералов у пациентов с телоген Ef fl u-

vium: ретроспективное поперечное исследование.J Drugs

Dermatol. 2016; 15 (10): 1235–7.

49. Ramsay ID, Rushton DH. Снижение уровня витамина

B12 в сыворотке крови при пероральном приеме ципротерона-ацетата и

этинилэстрадиола у женщин с диффузной

андроген-зависимой алопецией. Clin Exp Dermatol.

1990; 15 (4): 277–81.

50. Вальдес Ф. Витамин С. Actas Dermosi filiogr.

2006; 97 (9): 557–68.

51. Gropper SS, Smith J, Grodd JL. Водорастворимые витамины

.В: Gropper SS, Smith JL, Grodd JL, edi-

tors. Продвинутое питание и метаболизм человека,

4-е изд. Бельмонт: Томсон Уодсворт; 2004:

260–75.

52. Флеминг Дж. Д., Мартин Б., Кард-ди-джей, Меллерио Дж. Э. Боль,

пурпура и вьющиеся волосы. Clin Exp Dermatol.

2013; 38 (8): 940–2.

53. Кечичиан Э, Эззедин К. Витамин D и кожа:

обновление для дерматологов. Am J Clin Dermatol.

2018; 19 (2): 223–35.

54.D’Aurizio F, Villalta D, Metus P, Doretto P, Tozzoli

R. Является ли витамин D игроком или нет в патофизиологии аутоиммунных заболеваний щитовидной железы? Autoim-

мун Ред. 2015; 14 (5): 363–9.

55. Томпсон Дж. М., Мирза М. А., Парк М. К., Куреши А. А.,

Чо Э. Роль микронутриентов в облысении

areata: обзор. Am J Clin Dermatol.

2017; 18 (5): 663–79.

56. Antico A, Tampoia M, Tozzoli R, Bizzaro N. Может ли добавка

с витамином D снизить риск или

изменить течение аутоиммунных заболеваний? Систематический обзор литературы.Autoimmun Rev.

2012; 12 (2): 127–36.

57. Zhang X, Wang W, Li Y, Wang H, Liu R, Zhu L.

Статус 25-гидроксивитамина D в сыворотке у китайских детей

dren с витилиго: исследование случай – контроль. Clin Pediatr

(Phila). 2018; 57 (7): 802–5.

58. Djeraba Z, Benlabidi F, Djaballah-Ider FZ, Medjeber

O, Arroul-Lammali A, Belguendouz H, et al. Статус витамина

D у алжирских пациентов с болезнью Бехчета: иммуномодулирующий эффект

на путь NO.

Иммунофармакол Иммунотоксикол.

2017; 39 (4): 243–50.

59. Ван Л.М., Чжэн Чж., Ли Т.Ф. и др. 25-гидроксивита-

мин D связан с метаболическим синдромом

Dermatol Ther (Heidelb)

Как витамины и минералы влияют на выпадение волос? - Бюллетень медицинских новостей

В недавнем исследовании, опубликованном в журнале

Dermatology and Therapy , исследователи изучили роль минералов и витаминов при выпадении волос.

Выпадение волос - распространенная проблема, имеющая множество причин. Это может повлиять на кожу головы и другие участки тела. Каждый человек в той или иной степени испытывает облысение, и с возрастом оно становится все более частым. Выпадение волос может быть вызвано заболеваниями, приемом лекарств, гормональными изменениями, стрессом, плохим питанием и многим другим.

Мужчины чаще, чем женщины, испытывают выпадение волос, и оно может проявляться по-разному в зависимости от причины. Некоторые люди испытывают постепенное истончение волос на макушке, что является наиболее распространенным типом выпадения волос.Другие могут страдать от залысин или полного облысения.

Управлять выпадением волос сложно, и это может повлиять на качество жизни. Был изучен ряд вариантов лечения, включая замену волос, лекарства и пищевые добавки. Некоторые из этих методов лечения могут замедлить выпадение волос или стимулировать частичный отрастание волос, но многие из текущих вариантов имеют ограниченный успех.

В недавнем совместном исследовании, опубликованном в Dermatology and Therapy , американские и саудовские исследователи изучили, насколько эффективны витамины и минералы для лечения выпадения волос.Для исследования исследователи собрали клинические результаты из 125 статей о выпадении волос у людей. В их исследовании изучалась эффективность ряда питательных веществ для лечения выпадения волос, включая витамин A, витамин B, витамин C, витамин D, витамин E, железо, селен и цинк.

Здесь мы суммируем результаты их исследования.

1. Витамин А

Витамин А выполняет ряд важных функций в организме и играет роль в зрении, иммунной функции, а также в развитии и росте клеток.Рекомендуемая доза для взрослых 19 лет и старше составляет 4300 МЕ [международных единиц] в день. Согласно исследованиям, исследователи пришли к выводу, что чрезмерное потребление витамина А может вызвать выпадение волос. Пациенты, которые регулярно потребляли чрезмерное количество витамина А, демонстрировали выпадение волос, а те, кто принимал более 10000 МЕ каждый день, страдали от токсичности витамина А.

2. Витамин B

Витамин B - это комплексная группа витаминов, которая содержит ряд родственных соединений, поддерживающих обмен веществ.Из комплекса витаминов B только рибофлавин (витамин B2), биотин, фолат и витамин B12 связаны с выпадением волос. В западных странах дефицит рибофлавина и биотина встречается редко. Большинство людей получают достаточное количество этих питательных веществ из обычного рациона. Тем не менее, многие люди принимают добавки биотина, даже если они не являются дефицитными.

Люди с низким уровнем биотина могут испытывать выпадение волос, кожную сыпь и ломкость ногтей. Дефицит биотина может быть приобретенным или генетическим, и беременные женщины или лица с нарушениями всасывания подвергаются повышенному риску.Несмотря на эти симптомы низкого уровня биотина, это питательное вещество не поддерживается крупномасштабными исследованиями в качестве средства от выпадения волос. В целом, использование витаминов группы B при выпадении волос не подтверждено клиническими испытаниями.

3. Витамин C

Витамин С действует как сильный антиоксидант и участвует в правильном росте и развитии. Помимо прочего, витамин С помогает организму абсорбировать железо в пищеварительном тракте. Хотя витамин С важен для многих процессов в организме, нет никаких доказательств связи уровня витамина С с выпадением волос.Однако он может помочь пациентам с дефицитом железа и выпадением волос из-за его роли в абсорбции железа.

4. Витамин D

Витамин D - еще одно важное питательное вещество для роста и развития, способствует усвоению кальция в кишечнике и поддерживает уровень кальция в крови. Он также поддерживает рост костей, иммунную регуляцию и оказывает противовоспалительное действие.

Согласно клиническим исследованиям, витамин D может играть роль в выпадении волос. В частности, исследователи изучили роль витамина D в трех состояниях выпадения волос: аэратной алопеции (AA), андрогенетической алопеции (AGA) и телогенетической алопеции (TE).Каждое из этих состояний имеет разные причины и характер выпадения волос. Хотя результаты противоречивы, большинство исследований показали, что добавление витамина D может ограничить выпадение волос у пациентов с дефицитом витамина D. Несколько исследований также выявили прямую связь между низким уровнем витамина D и АК, которая может быть вызвана дисфункцией иммунной системы.

5. Витамин E

Витамин Е действует как антиоксидант, а также помогает иммунной функции. Однако, несмотря на роль витамина Е в иммунной регуляции, нет четких доказательств того, что он способствует выпадению волос.

6. Утюг

Железо является важным минералом для производства крови в организме. В основном он содержится в гемоглобине, белке красных кровяных телец, который помогает переносить кислород из легких в ткани организма. Он также содержится в ферритине, который хранит железо в других частях тела.

Исследования показали, что многие женщины с выпадением волос также страдают от дефицита железа. Большинство авторов предположили, что низкий уровень железа может быть связан с той или иной формой выпадения волос, хотя некоторые исследования показали противоречивые результаты.В целом, большинство исследований поддерживают добавление железа для пациентов с дефицитом железа и / или низким уровнем ферритина.

7. Селен

Селен играет важную роль в выработке многих белков в организме, которые поддерживают репродуктивную функцию, функцию щитовидной железы и другие процессы. Рекомендуемая суточная доза селена для людей в возрасте 14 лет и старше составляет 55 мкг. Данные, касающиеся выпадения волос и дефицита селена, ограничены. Однако исследования показали, что потребление селена более 400 микрограммов в день приводит к выпадению волос и другим симптомам, таким как тошнота, раздражительность и ломкость ногтей.

8. Цинк

Цинк поддерживает ряд функций организма, включая обмен веществ, рост и развитие клеток, иммунную функцию и многое другое. Дефицит цинка связан с определенными типами выпадения волос, однако данные о его роли в TE и AGA ограничены. Большинство исследований АК подтвердили, что у пациентов был низкий уровень цинка, но клинических исследований добавок цинка для лечения выпадения волос недостаточно.

Хотя витамины и минералы важны для развития волос и иммунной функции, необходимы более крупномасштабные клинические исследования, чтобы подтвердить ценность дополнительных минералов и витаминов при выпадении волос.Добавки определенных питательных веществ, включая витамин D и железо, могут быть полезны для пациентов с выпадением волос с определенными недостатками.

Автор Брейдон Блэк, бакалавр наук

Артикулы:

  1. Фонд Мейо медицинского образования и исследований. Выпадение волос [Интернет]. Рочестер, Миннесота: клиника Мэйо; (дата неизвестна) [цитируется 5 января 2019 г.]. Доступно по адресу: https://www.mayoclinic.org/diseases-conditions/hair-loss/symptoms-causes/syc-20372926.
  2. Альмоханна Х.М., Ахмед А.А., Цаталис Дж. П., Тости А.Роль витаминов и минералов при выпадении волос: обзор [Интернет]. Дерматол Тер (Heidelb). Epub 2018 13 декабря [цитируется 5 января 2019]. Доступно по ссылке: https://www.ncbi.nlm.nih.gov/pubmed/30547302 doi: 10.1007 / s13555-018-0278-6
  3. Улучшенный канал здоровья. Узорчатое облысение [Интернет]. Виктория, Австралия: Департамент здравоохранения и социальных служб правительства штата Виктория; [обновлено, апрель 2018 г .; цитируется 5 января 2019 г.]. Доступно по адресу: https://www.betterhealth.vic.gov.au/health/conditionsandtreatments/patterned-hair-loss
  4. Офис диетических добавок.Витамин С [Интернет]. Бетесда, Мэриленд: Национальные институты здоровья; [обновлено 18 сентября 2018 г .; цитируется 5 января 2019 г.]. Доступно по ссылке: https://ods.od.nih.gov/factsheets/VitaminC-HealthProfessional/
  5. Офис диетических добавок. Витамин D [Интернет]. Бетесда, Мэриленд: Национальные институты здоровья; [обновлено 9 ноября 2018 г .; цитируется 5 января 2019 г.]. Доступно по адресу: https://ods.od.nih.gov/factsheets/VitaminD-HealthProfessional/
  6. Офис диетических добавок. Железо [Интернет]. Бетесда, Мэриленд: Национальные институты здоровья; [обновлено 7 декабря 2018 г .; цитируется 5 января 2019 г.].Доступно по адресу: https://ods.od.nih.gov/factsheets/Iron-HealthProfessional/
  7. Офис диетических добавок. Железо [Интернет]. Бетесда, Мэриленд: Национальные институты здоровья; [обновлено 26 сентября 2018 г .

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *